Incidental Mutation 'R5076:Pdxk'
ID 395778
Institutional Source Beutler Lab
Gene Symbol Pdxk
Ensembl Gene ENSMUSG00000032788
Gene Name pyridoxal (pyridoxine, vitamin B6) kinase
Synonyms 2310036D04Rik
MMRRC Submission 042665-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5076 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 78272581-78300782 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 78286141 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 103 (Q103K)
Ref Sequence ENSEMBL: ENSMUSP00000038540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041616]
AlphaFold Q8K183
Predicted Effect probably benign
Transcript: ENSMUST00000041616
AA Change: Q103K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038540
Gene: ENSMUSG00000032788
AA Change: Q103K

DomainStartEndE-ValueType
Pfam:Phos_pyr_kin 69 285 1.4e-18 PFAM
Pfam:PfkB 95 277 1.3e-9 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000101024
Gene: ENSMUSG00000032788
AA Change: Q103K

DomainStartEndE-ValueType
Pfam:PfkB 4 259 1.6e-32 PFAM
Pfam:Phos_pyr_kin 70 252 3.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218245
Meta Mutation Damage Score 0.1648 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene phosphorylates vitamin B6, a step required for the conversion of vitamin B6 to pyridoxal-5-phosphate, an important cofactor in intermediary metabolism. The encoded protein is cytoplasmic and probably acts as a homodimer. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 89,963,559 (GRCm39) I72V probably benign Het
Aadacl3 G A 4: 144,182,640 (GRCm39) P276L possibly damaging Het
Acp6 T A 3: 97,075,305 (GRCm39) S180T probably benign Het
Adgrd1 A T 5: 129,221,053 (GRCm39) R449* probably null Het
Ak1 T C 2: 32,523,460 (GRCm39) V176A probably damaging Het
Capzb A T 4: 139,015,125 (GRCm39) D226V possibly damaging Het
Cd34 A T 1: 194,630,338 (GRCm39) probably benign Het
Cdh15 C A 8: 123,591,087 (GRCm39) D445E possibly damaging Het
Chil4 A G 3: 106,109,913 (GRCm39) F367L probably damaging Het
Clstn2 T C 9: 97,365,132 (GRCm39) Y458C probably damaging Het
Cplane2 A G 4: 140,944,696 (GRCm39) I82M probably benign Het
Ctsw T C 19: 5,518,486 (GRCm39) Y9C probably benign Het
Dhrs7 T C 12: 72,706,255 (GRCm39) D50G probably benign Het
Dnah14 A G 1: 181,584,799 (GRCm39) K3177E probably benign Het
Ehd1 T C 19: 6,327,251 (GRCm39) F83L probably benign Het
Eif5a2 G A 3: 28,836,886 (GRCm39) V59I possibly damaging Het
Emilin3 T A 2: 160,751,238 (GRCm39) probably null Het
Entpd8 A G 2: 24,975,066 (GRCm39) S426G possibly damaging Het
Epb41l4b C T 4: 57,040,984 (GRCm39) G493D probably damaging Het
Gm11596 C T 11: 99,683,698 (GRCm39) G141R unknown Het
Gpi-ps T G 8: 5,690,130 (GRCm39) noncoding transcript Het
H2-Q4 T C 17: 35,599,417 (GRCm39) Y167H probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Itpr1 A G 6: 108,382,490 (GRCm39) probably null Het
Kif2c A T 4: 117,032,066 (GRCm39) probably benign Het
Klrb1-ps1 C T 6: 129,096,751 (GRCm39) noncoding transcript Het
Krtap9-5 A T 11: 99,840,294 (GRCm39) T332S unknown Het
Lrrc39 A T 3: 116,373,189 (GRCm39) E283V probably benign Het
Mdga1 A G 17: 30,069,528 (GRCm39) S447P possibly damaging Het
Mindy1 G A 3: 95,202,710 (GRCm39) V425M probably benign Het
Mllt6 G A 11: 97,560,326 (GRCm39) S210N possibly damaging Het
Mrps5 T A 2: 127,442,772 (GRCm39) Y280* probably null Het
Muc3a T A 5: 137,244,997 (GRCm39) T159S probably damaging Het
Or10ad1b T A 15: 98,124,642 (GRCm39) I295F probably damaging Het
Or4a79 T A 2: 89,551,745 (GRCm39) T237S probably damaging Het
Or4f6 A T 2: 111,838,937 (GRCm39) M198K probably damaging Het
Pcdhga4 G A 18: 37,818,648 (GRCm39) V66I probably benign Het
Pdhx T C 2: 102,871,422 (GRCm39) T203A probably damaging Het
Pdss1 A G 2: 22,789,929 (GRCm39) probably null Het
Peg3 A G 7: 6,711,419 (GRCm39) C1268R probably damaging Het
Pitpnc1 A T 11: 107,187,093 (GRCm39) S77T probably damaging Het
Pnisr T A 4: 21,874,990 (GRCm39) probably benign Het
Poc1b C T 10: 98,943,703 (GRCm39) T22I probably damaging Het
Ppfia1 G A 7: 144,060,001 (GRCm39) R604W probably damaging Het
Ppp1r3a A G 6: 14,754,680 (GRCm39) F189S probably damaging Het
Rbks T A 5: 31,807,795 (GRCm39) Y99* probably null Het
Sh3rf2 G T 18: 42,186,989 (GRCm39) C36F probably damaging Het
Spock3 T A 8: 63,798,889 (GRCm39) N303K probably damaging Het
Tasor2 C T 13: 3,626,357 (GRCm39) V1198I probably benign Het
Tcaf2 T C 6: 42,606,401 (GRCm39) T518A probably benign Het
Tmem163 A T 1: 127,428,013 (GRCm39) V191D probably damaging Het
Trappc6b A G 12: 59,097,094 (GRCm39) V76A probably damaging Het
Ube2nl A G 7: 61,199,280 (GRCm39) noncoding transcript Het
Unc5d C T 8: 29,184,704 (GRCm39) V599M possibly damaging Het
Vmn1r184 A T 7: 25,966,346 (GRCm39) M31L probably benign Het
Vrtn C A 12: 84,696,248 (GRCm39) Q333K probably damaging Het
Zfp788 T A 7: 41,298,008 (GRCm39) F163I possibly damaging Het
Zfyve1 C T 12: 83,602,421 (GRCm39) R458H probably damaging Het
Other mutations in Pdxk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02556:Pdxk APN 10 78,287,319 (GRCm39) missense probably damaging 1.00
R1434:Pdxk UTSW 10 78,276,645 (GRCm39) missense probably benign 0.01
R1572:Pdxk UTSW 10 78,283,814 (GRCm39) missense probably damaging 1.00
R1719:Pdxk UTSW 10 78,279,730 (GRCm39) missense probably benign
R1970:Pdxk UTSW 10 78,276,988 (GRCm39) missense probably damaging 1.00
R2962:Pdxk UTSW 10 78,279,667 (GRCm39) missense probably damaging 1.00
R4094:Pdxk UTSW 10 78,300,644 (GRCm39) missense probably damaging 1.00
R4095:Pdxk UTSW 10 78,300,644 (GRCm39) missense probably damaging 1.00
R4613:Pdxk UTSW 10 78,283,753 (GRCm39) missense probably damaging 0.99
R4686:Pdxk UTSW 10 78,282,837 (GRCm39) splice site probably null
R4783:Pdxk UTSW 10 78,300,626 (GRCm39) missense possibly damaging 0.72
R4980:Pdxk UTSW 10 78,287,318 (GRCm39) missense probably damaging 1.00
R5847:Pdxk UTSW 10 78,280,872 (GRCm39) missense probably benign
R6145:Pdxk UTSW 10 78,279,625 (GRCm39) missense probably benign 0.44
R7109:Pdxk UTSW 10 78,282,810 (GRCm39) missense probably damaging 1.00
R7399:Pdxk UTSW 10 78,276,697 (GRCm39) missense probably benign 0.00
R7445:Pdxk UTSW 10 78,283,801 (GRCm39) missense probably benign
R7629:Pdxk UTSW 10 78,280,840 (GRCm39) missense probably benign
R7700:Pdxk UTSW 10 78,279,764 (GRCm39) splice site probably null
R7936:Pdxk UTSW 10 78,277,012 (GRCm39) missense possibly damaging 0.93
R8178:Pdxk UTSW 10 78,289,338 (GRCm39) missense probably damaging 0.99
R8780:Pdxk UTSW 10 78,283,786 (GRCm39) missense probably benign 0.04
R8783:Pdxk UTSW 10 78,287,339 (GRCm39) missense probably benign 0.06
R8964:Pdxk UTSW 10 78,283,771 (GRCm39) missense probably benign 0.17
R9658:Pdxk UTSW 10 78,287,403 (GRCm39) missense probably benign 0.07
Z1176:Pdxk UTSW 10 78,277,022 (GRCm39) missense probably damaging 1.00
Z1177:Pdxk UTSW 10 78,279,739 (GRCm39) missense probably benign 0.33
Z1189:Pdxk UTSW 10 78,280,895 (GRCm39) missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TCCTGATGACGAAGCCACAAG -3'
(R):5'- TTCAGACCATTGGGAACACCC -3'

Sequencing Primer
(F):5'- AGGCTTCTCCTTAGAGGTCTCATG -3'
(R):5'- TTGGGAACACCCTGCATC -3'
Posted On 2016-06-21