Incidental Mutation 'R5076:Poc1b'
ID395779
Institutional Source Beutler Lab
Gene Symbol Poc1b
Ensembl Gene ENSMUSG00000019952
Gene NamePOC1 centriolar protein B
Synonyms4933430F16Rik, Wdr51b
MMRRC Submission 042665-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5076 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location99107036-99198074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99107841 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 22 (T22I)
Ref Sequence ENSEMBL: ENSMUSP00000124144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020113] [ENSMUST00000159228] [ENSMUST00000159990] [ENSMUST00000161240] [ENSMUST00000219884]
Predicted Effect probably damaging
Transcript: ENSMUST00000020113
AA Change: T22I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020113
Gene: ENSMUSG00000019952
AA Change: T22I

DomainStartEndE-ValueType
WD40 7 46 1.71e-7 SMART
WD40 49 88 8.68e-9 SMART
WD40 91 130 2.71e-10 SMART
WD40 133 172 2.43e-12 SMART
WD40 175 214 2.07e-6 SMART
WD40 217 256 1.71e-7 SMART
WD40 259 298 7.55e-9 SMART
coiled coil region 428 468 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159228
AA Change: T22I

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124144
Gene: ENSMUSG00000019952
AA Change: T22I

DomainStartEndE-ValueType
WD40 7 46 1.71e-7 SMART
WD40 49 88 8.68e-9 SMART
WD40 91 130 2.71e-10 SMART
WD40 133 172 2.43e-12 SMART
WD40 175 214 2.07e-6 SMART
WD40 217 256 1.71e-7 SMART
WD40 259 298 7.55e-9 SMART
coiled coil region 401 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159990
SMART Domains Protein: ENSMUSP00000125423
Gene: ENSMUSG00000019952

DomainStartEndE-ValueType
WD40 7 46 8.68e-9 SMART
WD40 49 88 2.71e-10 SMART
WD40 91 130 2.43e-12 SMART
WD40 133 172 2.07e-6 SMART
WD40 175 214 1.71e-7 SMART
WD40 217 256 7.55e-9 SMART
coiled coil region 386 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161240
SMART Domains Protein: ENSMUSP00000125315
Gene: ENSMUSG00000090035

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 135 382 4.7e-10 PFAM
Pfam:Glycos_transf_2 138 321 7.5e-38 PFAM
Pfam:Glyco_tranf_2_2 138 368 1e-7 PFAM
Pfam:Glyco_transf_7C 298 367 4.5e-10 PFAM
low complexity region 411 420 N/A INTRINSIC
RICIN 445 577 2.39e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218379
Predicted Effect probably damaging
Transcript: ENSMUST00000219884
AA Change: T22I

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220019
Meta Mutation Damage Score 0.4657 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] POC1 proteins contain an N-terminal WD40 domain and a C-terminal coiled coil domain and are part of centrosomes. They play an important role in basal body and cilia formation. This gene encodes one of the two POC1 proteins found in humans. Mutation in this gene result in autosomal-recessive cone-rod dystrophy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 90,056,252 I72V probably benign Het
Aadacl3 G A 4: 144,456,070 P276L possibly damaging Het
Acp6 T A 3: 97,167,989 S180T probably benign Het
Adgrd1 A T 5: 129,143,989 R449* probably null Het
Ak1 T C 2: 32,633,448 V176A probably damaging Het
Capzb A T 4: 139,287,814 D226V possibly damaging Het
Cd34 A T 1: 194,948,030 probably benign Het
Cdh15 C A 8: 122,864,348 D445E possibly damaging Het
Chil4 A G 3: 106,202,597 F367L probably damaging Het
Clstn2 T C 9: 97,483,079 Y458C probably damaging Het
Ctsw T C 19: 5,468,458 Y9C probably benign Het
Dhrs7 T C 12: 72,659,481 D50G probably benign Het
Dnah14 A G 1: 181,757,234 K3177E probably benign Het
Ehd1 T C 19: 6,277,221 F83L probably benign Het
Eif5a2 G A 3: 28,782,737 V59I possibly damaging Het
Emilin3 T A 2: 160,909,318 probably null Het
Entpd8 A G 2: 25,085,054 S426G possibly damaging Het
Epb41l4b C T 4: 57,040,984 G493D probably damaging Het
Fam208b C T 13: 3,576,357 V1198I probably benign Het
Gm11596 C T 11: 99,792,872 G141R unknown Het
Gm1840 T G 8: 5,640,130 noncoding transcript Het
H2-Q4 T C 17: 35,380,441 Y167H probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Itpr1 A G 6: 108,405,529 probably null Het
Kif2c A T 4: 117,174,869 probably benign Het
Klrb1-ps1 C T 6: 129,119,788 noncoding transcript Het
Krtap9-5 A T 11: 99,949,468 T332S unknown Het
Lrrc39 A T 3: 116,579,540 E283V probably benign Het
Mdga1 A G 17: 29,850,554 S447P possibly damaging Het
Mindy1 G A 3: 95,295,399 V425M probably benign Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Muc3a T A 5: 137,210,540 T159S probably damaging Het
Olfr1252 T A 2: 89,721,401 T237S probably damaging Het
Olfr1310 A T 2: 112,008,592 M198K probably damaging Het
Olfr286 T A 15: 98,226,761 I295F probably damaging Het
Pcdhga4 G A 18: 37,685,595 V66I probably benign Het
Pdhx T C 2: 103,041,077 T203A probably damaging Het
Pdss1 A G 2: 22,899,917 probably null Het
Pdxk G T 10: 78,450,307 Q103K probably benign Het
Peg3 A G 7: 6,708,420 C1268R probably damaging Het
Pitpnc1 A T 11: 107,296,267 S77T probably damaging Het
Pnisr T A 4: 21,874,990 probably benign Het
Ppfia1 G A 7: 144,506,264 R604W probably damaging Het
Ppp1r3a A G 6: 14,754,681 F189S probably damaging Het
Rbks T A 5: 31,650,451 Y99* probably null Het
Rsg1 A G 4: 141,217,385 I82M probably benign Het
Sh3rf2 G T 18: 42,053,924 C36F probably damaging Het
Spock3 T A 8: 63,345,855 N303K probably damaging Het
Tcaf2 T C 6: 42,629,467 T518A probably benign Het
Tmem163 A T 1: 127,500,276 V191D probably damaging Het
Trappc6b A G 12: 59,050,308 V76A probably damaging Het
Ube2nl A G 7: 61,549,532 noncoding transcript Het
Unc5d C T 8: 28,694,676 V599M possibly damaging Het
Vmn1r184 A T 7: 26,266,921 M31L probably benign Het
Vrtn C A 12: 84,649,474 Q333K probably damaging Het
Zfp788 T A 7: 41,648,584 F163I possibly damaging Het
Zfyve1 C T 12: 83,555,647 R458H probably damaging Het
Other mutations in Poc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Poc1b APN 10 99129652 missense probably benign 0.29
IGL01314:Poc1b APN 10 99129641 missense probably damaging 1.00
IGL02503:Poc1b APN 10 99144348 splice site probably benign
IGL02839:Poc1b APN 10 99144598 splice site probably benign
IGL02966:Poc1b APN 10 99144314 missense probably damaging 1.00
R0708:Poc1b UTSW 10 99155130 missense probably null 0.99
R0723:Poc1b UTSW 10 99129595 missense probably damaging 1.00
R1423:Poc1b UTSW 10 99152863 missense probably damaging 1.00
R4383:Poc1b UTSW 10 99156299 missense probably damaging 1.00
R4426:Poc1b UTSW 10 99155139 critical splice donor site probably null
R4427:Poc1b UTSW 10 99155139 critical splice donor site probably null
R6355:Poc1b UTSW 10 99129574 missense probably damaging 1.00
R6731:Poc1b UTSW 10 99152871 missense probably null 1.00
R6833:Poc1b UTSW 10 99192804 missense probably benign 0.16
R6834:Poc1b UTSW 10 99192804 missense probably benign 0.16
R7184:Poc1b UTSW 10 99134337 missense probably benign 0.01
R7794:Poc1b UTSW 10 99129598 missense possibly damaging 0.67
R7982:Poc1b UTSW 10 99164902 missense probably benign 0.28
R8172:Poc1b UTSW 10 99144476 splice site probably null
R8182:Poc1b UTSW 10 99155143 splice site probably null
Z1177:Poc1b UTSW 10 99144513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGCCGGGTTGTAATG -3'
(R):5'- TCGAGTCCTTACCCAGCAAAG -3'

Sequencing Primer
(F):5'- GGTTGTAATGCCCACGCCTC -3'
(R):5'- AGACCCAGGGACCCAGAGTG -3'
Posted On2016-06-21