Incidental Mutation 'R5076:Dhrs7'
ID395785
Institutional Source Beutler Lab
Gene Symbol Dhrs7
Ensembl Gene ENSMUSG00000021094
Gene Namedehydrogenase/reductase (SDR family) member 7
SynonymsretSDR4, 2310016E22Rik, 5730564L20Rik, retDSR4
MMRRC Submission 042665-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R5076 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location72650353-72664909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72659481 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 50 (D50G)
Ref Sequence ENSEMBL: ENSMUSP00000152329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021512] [ENSMUST00000220821]
Predicted Effect probably benign
Transcript: ENSMUST00000021512
AA Change: D50G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021512
Gene: ENSMUSG00000021094
AA Change: D50G

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:KR 51 227 2.5e-11 PFAM
Pfam:adh_short 51 250 4.4e-52 PFAM
Pfam:adh_short_C2 57 267 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220821
AA Change: D50G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221674
Predicted Effect unknown
Transcript: ENSMUST00000221750
AA Change: D47G
Meta Mutation Damage Score 0.0599 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) family, which has over 46,000 members. Members in this family are enzymes that metabolize many different compounds, such as steroid hormones, prostaglandins, retinoids, lipids and xenobiotics. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 90,056,252 I72V probably benign Het
Aadacl3 G A 4: 144,456,070 P276L possibly damaging Het
Acp6 T A 3: 97,167,989 S180T probably benign Het
Adgrd1 A T 5: 129,143,989 R449* probably null Het
Ak1 T C 2: 32,633,448 V176A probably damaging Het
Capzb A T 4: 139,287,814 D226V possibly damaging Het
Cd34 A T 1: 194,948,030 probably benign Het
Cdh15 C A 8: 122,864,348 D445E possibly damaging Het
Chil4 A G 3: 106,202,597 F367L probably damaging Het
Clstn2 T C 9: 97,483,079 Y458C probably damaging Het
Ctsw T C 19: 5,468,458 Y9C probably benign Het
Dnah14 A G 1: 181,757,234 K3177E probably benign Het
Ehd1 T C 19: 6,277,221 F83L probably benign Het
Eif5a2 G A 3: 28,782,737 V59I possibly damaging Het
Emilin3 T A 2: 160,909,318 probably null Het
Entpd8 A G 2: 25,085,054 S426G possibly damaging Het
Epb41l4b C T 4: 57,040,984 G493D probably damaging Het
Fam208b C T 13: 3,576,357 V1198I probably benign Het
Gm11596 C T 11: 99,792,872 G141R unknown Het
Gm1840 T G 8: 5,640,130 noncoding transcript Het
H2-Q4 T C 17: 35,380,441 Y167H probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Itpr1 A G 6: 108,405,529 probably null Het
Kif2c A T 4: 117,174,869 probably benign Het
Klrb1-ps1 C T 6: 129,119,788 noncoding transcript Het
Krtap9-5 A T 11: 99,949,468 T332S unknown Het
Lrrc39 A T 3: 116,579,540 E283V probably benign Het
Mdga1 A G 17: 29,850,554 S447P possibly damaging Het
Mindy1 G A 3: 95,295,399 V425M probably benign Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Muc3a T A 5: 137,210,540 T159S probably damaging Het
Olfr1252 T A 2: 89,721,401 T237S probably damaging Het
Olfr1310 A T 2: 112,008,592 M198K probably damaging Het
Olfr286 T A 15: 98,226,761 I295F probably damaging Het
Pcdhga4 G A 18: 37,685,595 V66I probably benign Het
Pdhx T C 2: 103,041,077 T203A probably damaging Het
Pdss1 A G 2: 22,899,917 probably null Het
Pdxk G T 10: 78,450,307 Q103K probably benign Het
Peg3 A G 7: 6,708,420 C1268R probably damaging Het
Pitpnc1 A T 11: 107,296,267 S77T probably damaging Het
Pnisr T A 4: 21,874,990 probably benign Het
Poc1b C T 10: 99,107,841 T22I probably damaging Het
Ppfia1 G A 7: 144,506,264 R604W probably damaging Het
Ppp1r3a A G 6: 14,754,681 F189S probably damaging Het
Rbks T A 5: 31,650,451 Y99* probably null Het
Rsg1 A G 4: 141,217,385 I82M probably benign Het
Sh3rf2 G T 18: 42,053,924 C36F probably damaging Het
Spock3 T A 8: 63,345,855 N303K probably damaging Het
Tcaf2 T C 6: 42,629,467 T518A probably benign Het
Tmem163 A T 1: 127,500,276 V191D probably damaging Het
Trappc6b A G 12: 59,050,308 V76A probably damaging Het
Ube2nl A G 7: 61,549,532 noncoding transcript Het
Unc5d C T 8: 28,694,676 V599M possibly damaging Het
Vmn1r184 A T 7: 26,266,921 M31L probably benign Het
Vrtn C A 12: 84,649,474 Q333K probably damaging Het
Zfp788 T A 7: 41,648,584 F163I possibly damaging Het
Zfyve1 C T 12: 83,555,647 R458H probably damaging Het
Other mutations in Dhrs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dhrs7 APN 12 72659350 missense probably damaging 1.00
IGL00715:Dhrs7 APN 12 72652390 missense probably damaging 1.00
IGL02398:Dhrs7 APN 12 72664692 missense probably damaging 1.00
R0421:Dhrs7 UTSW 12 72653086 splice site probably benign
R0691:Dhrs7 UTSW 12 72652351 missense probably damaging 1.00
R1640:Dhrs7 UTSW 12 72652315 missense possibly damaging 0.86
R1696:Dhrs7 UTSW 12 72653120 missense possibly damaging 0.88
R1727:Dhrs7 UTSW 12 72659464 missense probably damaging 1.00
R1791:Dhrs7 UTSW 12 72653165 missense probably benign 0.13
R2046:Dhrs7 UTSW 12 72652266 missense possibly damaging 0.47
R2124:Dhrs7 UTSW 12 72653177 missense probably damaging 1.00
R2205:Dhrs7 UTSW 12 72656370 missense probably damaging 1.00
R2356:Dhrs7 UTSW 12 72652381 missense probably benign 0.00
R3431:Dhrs7 UTSW 12 72664727 missense probably damaging 0.99
R4492:Dhrs7 UTSW 12 72653125 missense probably damaging 1.00
R4744:Dhrs7 UTSW 12 72652251 missense possibly damaging 0.94
R4747:Dhrs7 UTSW 12 72653118 missense probably benign 0.03
R5050:Dhrs7 UTSW 12 72657410 missense probably damaging 1.00
R5678:Dhrs7 UTSW 12 72657332 missense probably damaging 1.00
R6361:Dhrs7 UTSW 12 72664659 missense probably damaging 0.98
R7895:Dhrs7 UTSW 12 72652460 splice site probably null
R8432:Dhrs7 UTSW 12 72664807 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGGAGCCAACATGTACCAC -3'
(R):5'- CATGACACTTGAAATTTTAGGCTCC -3'

Sequencing Primer
(F):5'- CCAAAGCTGCGCTGAGTTTG -3'
(R):5'- TTTTAGGCTCCAAATATTAGACCTTC -3'
Posted On2016-06-21