Incidental Mutation 'R5076:Fam208b'
ID395788
Institutional Source Beutler Lab
Gene Symbol Fam208b
Ensembl Gene ENSMUSG00000033799
Gene Namefamily with sequence similarity 208, member B
SynonymsBC016423
MMRRC Submission 042665-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R5076 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location3566035-3611108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3576357 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1198 (V1198I)
Ref Sequence ENSEMBL: ENSMUSP00000093774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096069]
Predicted Effect probably benign
Transcript: ENSMUST00000096069
AA Change: V1198I

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000093774
Gene: ENSMUSG00000033799
AA Change: V1198I

DomainStartEndE-ValueType
Pfam:DUF3699 91 167 1.4e-24 PFAM
low complexity region 272 282 N/A INTRINSIC
low complexity region 447 459 N/A INTRINSIC
Pfam:DUF3715 533 695 2.3e-25 PFAM
low complexity region 1156 1168 N/A INTRINSIC
low complexity region 1196 1207 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 2012 2021 N/A INTRINSIC
low complexity region 2250 2263 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221059
Predicted Effect unknown
Transcript: ENSMUST00000222909
AA Change: V516I
Meta Mutation Damage Score 0.0870 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 90,056,252 I72V probably benign Het
Aadacl3 G A 4: 144,456,070 P276L possibly damaging Het
Acp6 T A 3: 97,167,989 S180T probably benign Het
Adgrd1 A T 5: 129,143,989 R449* probably null Het
Ak1 T C 2: 32,633,448 V176A probably damaging Het
Capzb A T 4: 139,287,814 D226V possibly damaging Het
Cd34 A T 1: 194,948,030 probably benign Het
Cdh15 C A 8: 122,864,348 D445E possibly damaging Het
Chil4 A G 3: 106,202,597 F367L probably damaging Het
Clstn2 T C 9: 97,483,079 Y458C probably damaging Het
Ctsw T C 19: 5,468,458 Y9C probably benign Het
Dhrs7 T C 12: 72,659,481 D50G probably benign Het
Dnah14 A G 1: 181,757,234 K3177E probably benign Het
Ehd1 T C 19: 6,277,221 F83L probably benign Het
Eif5a2 G A 3: 28,782,737 V59I possibly damaging Het
Emilin3 T A 2: 160,909,318 probably null Het
Entpd8 A G 2: 25,085,054 S426G possibly damaging Het
Epb41l4b C T 4: 57,040,984 G493D probably damaging Het
Gm11596 C T 11: 99,792,872 G141R unknown Het
Gm1840 T G 8: 5,640,130 noncoding transcript Het
H2-Q4 T C 17: 35,380,441 Y167H probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Itpr1 A G 6: 108,405,529 probably null Het
Kif2c A T 4: 117,174,869 probably benign Het
Klrb1-ps1 C T 6: 129,119,788 noncoding transcript Het
Krtap9-5 A T 11: 99,949,468 T332S unknown Het
Lrrc39 A T 3: 116,579,540 E283V probably benign Het
Mdga1 A G 17: 29,850,554 S447P possibly damaging Het
Mindy1 G A 3: 95,295,399 V425M probably benign Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Muc3a T A 5: 137,210,540 T159S probably damaging Het
Olfr1252 T A 2: 89,721,401 T237S probably damaging Het
Olfr1310 A T 2: 112,008,592 M198K probably damaging Het
Olfr286 T A 15: 98,226,761 I295F probably damaging Het
Pcdhga4 G A 18: 37,685,595 V66I probably benign Het
Pdhx T C 2: 103,041,077 T203A probably damaging Het
Pdss1 A G 2: 22,899,917 probably null Het
Pdxk G T 10: 78,450,307 Q103K probably benign Het
Peg3 A G 7: 6,708,420 C1268R probably damaging Het
Pitpnc1 A T 11: 107,296,267 S77T probably damaging Het
Pnisr T A 4: 21,874,990 probably benign Het
Poc1b C T 10: 99,107,841 T22I probably damaging Het
Ppfia1 G A 7: 144,506,264 R604W probably damaging Het
Ppp1r3a A G 6: 14,754,681 F189S probably damaging Het
Rbks T A 5: 31,650,451 Y99* probably null Het
Rsg1 A G 4: 141,217,385 I82M probably benign Het
Sh3rf2 G T 18: 42,053,924 C36F probably damaging Het
Spock3 T A 8: 63,345,855 N303K probably damaging Het
Tcaf2 T C 6: 42,629,467 T518A probably benign Het
Tmem163 A T 1: 127,500,276 V191D probably damaging Het
Trappc6b A G 12: 59,050,308 V76A probably damaging Het
Ube2nl A G 7: 61,549,532 noncoding transcript Het
Unc5d C T 8: 28,694,676 V599M possibly damaging Het
Vmn1r184 A T 7: 26,266,921 M31L probably benign Het
Vrtn C A 12: 84,649,474 Q333K probably damaging Het
Zfp788 T A 7: 41,648,584 F163I possibly damaging Het
Zfyve1 C T 12: 83,555,647 R458H probably damaging Het
Other mutations in Fam208b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Fam208b APN 13 3574832 missense probably benign
IGL00670:Fam208b APN 13 3585241 missense probably benign 0.14
IGL00957:Fam208b APN 13 3577101 missense possibly damaging 0.86
IGL01311:Fam208b APN 13 3575885 missense possibly damaging 0.85
IGL01318:Fam208b APN 13 3575067 missense possibly damaging 0.66
IGL01767:Fam208b APN 13 3576633 missense probably benign 0.00
IGL02073:Fam208b APN 13 3574721 missense probably benign 0.01
IGL02152:Fam208b APN 13 3585371 missense probably benign
IGL02431:Fam208b APN 13 3574736 missense possibly damaging 0.85
IGL02478:Fam208b APN 13 3574661 missense probably benign 0.12
IGL02732:Fam208b APN 13 3573626 missense probably benign 0.09
IGL02745:Fam208b APN 13 3585140 missense probably benign 0.23
IGL02800:Fam208b APN 13 3585154 missense probably benign
IGL02989:Fam208b APN 13 3584820 missense probably benign 0.01
IGL03124:Fam208b APN 13 3574704 missense probably benign 0.41
IGL03154:Fam208b APN 13 3575255 missense possibly damaging 0.56
IGL03216:Fam208b APN 13 3574553 missense probably damaging 0.98
BB001:Fam208b UTSW 13 3594331 missense possibly damaging 0.92
BB011:Fam208b UTSW 13 3594331 missense possibly damaging 0.92
H8562:Fam208b UTSW 13 3577000 missense probably damaging 0.98
PIT4585001:Fam208b UTSW 13 3574979 missense possibly damaging 0.55
R0016:Fam208b UTSW 13 3585170 splice site probably null
R0016:Fam208b UTSW 13 3585170 splice site probably null
R0157:Fam208b UTSW 13 3575550 missense probably benign 0.06
R0375:Fam208b UTSW 13 3596842 missense possibly damaging 0.85
R0403:Fam208b UTSW 13 3582052 nonsense probably null
R0472:Fam208b UTSW 13 3588364 missense possibly damaging 0.93
R0517:Fam208b UTSW 13 3566964 missense possibly damaging 0.94
R0586:Fam208b UTSW 13 3590321 missense probably damaging 0.99
R0600:Fam208b UTSW 13 3576054 missense probably benign
R0659:Fam208b UTSW 13 3574448 missense probably damaging 0.99
R1257:Fam208b UTSW 13 3575049 missense probably benign 0.25
R1375:Fam208b UTSW 13 3576029 missense probably benign 0.06
R1443:Fam208b UTSW 13 3575543 missense probably benign 0.00
R1497:Fam208b UTSW 13 3570409 missense probably damaging 0.96
R1544:Fam208b UTSW 13 3590413 missense possibly damaging 0.68
R1554:Fam208b UTSW 13 3576374 missense possibly damaging 0.85
R1629:Fam208b UTSW 13 3574121 missense possibly damaging 0.84
R1633:Fam208b UTSW 13 3581771 missense possibly damaging 0.53
R1661:Fam208b UTSW 13 3573860 missense possibly damaging 0.63
R1673:Fam208b UTSW 13 3584498 critical splice donor site probably null
R1675:Fam208b UTSW 13 3569507 missense possibly damaging 0.65
R1781:Fam208b UTSW 13 3584759 missense possibly damaging 0.95
R1792:Fam208b UTSW 13 3590559 missense possibly damaging 0.91
R1826:Fam208b UTSW 13 3581759 missense probably damaging 0.98
R1920:Fam208b UTSW 13 3576612 missense possibly damaging 0.63
R1983:Fam208b UTSW 13 3574853 missense possibly damaging 0.92
R2016:Fam208b UTSW 13 3576770 missense probably benign 0.41
R2017:Fam208b UTSW 13 3576770 missense probably benign 0.41
R2220:Fam208b UTSW 13 3581872 missense probably benign 0.00
R2513:Fam208b UTSW 13 3582150 missense possibly damaging 0.53
R2898:Fam208b UTSW 13 3585122 missense possibly damaging 0.82
R2904:Fam208b UTSW 13 3582185 missense possibly damaging 0.53
R3149:Fam208b UTSW 13 3574359 missense probably damaging 0.98
R3623:Fam208b UTSW 13 3595556 missense probably benign
R3624:Fam208b UTSW 13 3595556 missense probably benign
R3725:Fam208b UTSW 13 3590538 missense probably benign 0.33
R3835:Fam208b UTSW 13 3575292 missense probably benign 0.01
R3890:Fam208b UTSW 13 3596785 missense probably damaging 0.96
R4023:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4024:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4025:Fam208b UTSW 13 3584554 missense probably damaging 0.99
R4050:Fam208b UTSW 13 3573507 missense probably benign 0.09
R4308:Fam208b UTSW 13 3569498 missense probably damaging 0.97
R4484:Fam208b UTSW 13 3581831 missense probably benign 0.12
R4674:Fam208b UTSW 13 3573686 missense possibly damaging 0.69
R4718:Fam208b UTSW 13 3574495 missense probably benign 0.00
R4745:Fam208b UTSW 13 3590069 missense probably benign 0.26
R4776:Fam208b UTSW 13 3570391 missense probably damaging 1.00
R4839:Fam208b UTSW 13 3584807 missense probably damaging 0.96
R4855:Fam208b UTSW 13 3566680 splice site probably null
R5049:Fam208b UTSW 13 3574000 missense probably benign 0.00
R5287:Fam208b UTSW 13 3575744 missense probably benign 0.41
R5298:Fam208b UTSW 13 3595613 splice site probably null
R5379:Fam208b UTSW 13 3588496 missense probably benign 0.41
R5512:Fam208b UTSW 13 3595517 missense probably damaging 0.99
R5624:Fam208b UTSW 13 3584996 missense possibly damaging 0.66
R5750:Fam208b UTSW 13 3573642 nonsense probably null
R6114:Fam208b UTSW 13 3590081 missense probably damaging 1.00
R6118:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6119:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6269:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6270:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6271:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6272:Fam208b UTSW 13 3581891 missense possibly damaging 0.76
R6525:Fam208b UTSW 13 3576540 nonsense probably null
R6550:Fam208b UTSW 13 3590519 missense possibly damaging 0.85
R6714:Fam208b UTSW 13 3594189 missense probably benign 0.00
R6797:Fam208b UTSW 13 3576769 missense probably benign 0.26
R6967:Fam208b UTSW 13 3574819 missense probably benign 0.22
R7016:Fam208b UTSW 13 3576857 missense possibly damaging 0.92
R7219:Fam208b UTSW 13 3590521 missense probably damaging 0.99
R7454:Fam208b UTSW 13 3585332 missense probably benign 0.21
R7570:Fam208b UTSW 13 3573621 missense probably damaging 0.99
R7571:Fam208b UTSW 13 3575292 missense probably benign 0.01
R7580:Fam208b UTSW 13 3574752 missense probably damaging 0.99
R7587:Fam208b UTSW 13 3568849 missense possibly damaging 0.83
R7657:Fam208b UTSW 13 3573777 missense probably damaging 0.98
R7810:Fam208b UTSW 13 3575714 missense possibly damaging 0.61
R7909:Fam208b UTSW 13 3573765 missense possibly damaging 0.93
R7924:Fam208b UTSW 13 3594331 missense possibly damaging 0.92
R7945:Fam208b UTSW 13 3576085 missense probably benign
R8005:Fam208b UTSW 13 3575681 missense probably benign
R8067:Fam208b UTSW 13 3569602 missense probably benign
R8112:Fam208b UTSW 13 3569516 missense probably damaging 1.00
R8162:Fam208b UTSW 13 3599691 missense probably damaging 0.96
R8170:Fam208b UTSW 13 3574881 nonsense probably null
R8240:Fam208b UTSW 13 3574388 missense probably benign
R8263:Fam208b UTSW 13 3575286 missense possibly damaging 0.70
R8263:Fam208b UTSW 13 3590016 missense probably benign 0.03
X0024:Fam208b UTSW 13 3599837 missense probably null 0.99
X0025:Fam208b UTSW 13 3576827 missense probably benign 0.15
X0066:Fam208b UTSW 13 3588441 missense probably benign 0.04
Z1176:Fam208b UTSW 13 3576636 missense probably benign 0.01
Z1176:Fam208b UTSW 13 3588429 missense probably damaging 0.98
Z1177:Fam208b UTSW 13 3574234 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCCTCTTCAGTGAGAGATCAG -3'
(R):5'- AGTAAGTGCCTTTCTGCCTC -3'

Sequencing Primer
(F):5'- GAGAGATCAGTTTGTTTGGGAAATAC -3'
(R):5'- TTACAGAAAGAGATTCCTCCTCTGAC -3'
Posted On2016-06-21