Mutagenetix > Incidental Mutation

Incidental Mutation 'R5076:Fam208b'

395788

Institutional Source

Beutler Lab

Gene Symbol

Fam208b

Ensembl Gene

ENSMUSG00000033799

Gene Name

family with sequence similarity 208, member B

Synonyms

BC016423

MMRRC Submission

042665-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R5076 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3566035-3611108 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 3576357 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 1198 (V1198I)

Ref Sequence

ENSEMBL: ENSMUSP00000093774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096069]

AlphaFold

Q5DTT3

Predicted Effect

probably benign
Transcript: ENSMUST00000096069
AA Change: V1198I

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000093774
Gene: ENSMUSG00000033799
AA Change: V1198I

Domain	Start	End	E-Value	Type
Pfam:DUF3699	91	167	1.4e-24	PFAM
low complexity region	272	282	N/A	INTRINSIC
low complexity region	447	459	N/A	INTRINSIC
Pfam:DUF3715	533	695	2.3e-25	PFAM
low complexity region	1156	1168	N/A	INTRINSIC
low complexity region	1196	1207	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
low complexity region	2012	2021	N/A	INTRINSIC
low complexity region	2250	2263	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221059

Predicted Effect

unknown
Transcript: ENSMUST00000222909
AA Change: V516I

Meta Mutation Damage Score

0.0870

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.0%

Validation Efficiency

97% (66/68)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933434E20Rik	A	G	3: 90,056,252	I72V	probably benign	Het
Aadacl3	G	A	4: 144,456,070	P276L	possibly damaging	Het
Acp6	T	A	3: 97,167,989	S180T	probably benign	Het
Adgrd1	A	T	5: 129,143,989	R449*	probably null	Het
Ak1	T	C	2: 32,633,448	V176A	probably damaging	Het
Capzb	A	T	4: 139,287,814	D226V	possibly damaging	Het
Cd34	A	T	1: 194,948,030		probably benign	Het
Cdh15	C	A	8: 122,864,348	D445E	possibly damaging	Het
Chil4	A	G	3: 106,202,597	F367L	probably damaging	Het
Clstn2	T	C	9: 97,483,079	Y458C	probably damaging	Het
Ctsw	T	C	19: 5,468,458	Y9C	probably benign	Het
Dhrs7	T	C	12: 72,659,481	D50G	probably benign	Het
Dnah14	A	G	1: 181,757,234	K3177E	probably benign	Het
Ehd1	T	C	19: 6,277,221	F83L	probably benign	Het
Eif5a2	G	A	3: 28,782,737	V59I	possibly damaging	Het
Emilin3	T	A	2: 160,909,318		probably null	Het
Entpd8	A	G	2: 25,085,054	S426G	possibly damaging	Het
Epb41l4b	C	T	4: 57,040,984	G493D	probably damaging	Het
Gm11596	C	T	11: 99,792,872	G141R	unknown	Het
Gm1840	T	G	8: 5,640,130		noncoding transcript	Het
H2-Q4	T	C	17: 35,380,441	Y167H	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Itpr1	A	G	6: 108,405,529		probably null	Het
Kif2c	A	T	4: 117,174,869		probably benign	Het
Klrb1-ps1	C	T	6: 129,119,788		noncoding transcript	Het
Krtap9-5	A	T	11: 99,949,468	T332S	unknown	Het
Lrrc39	A	T	3: 116,579,540	E283V	probably benign	Het
Mdga1	A	G	17: 29,850,554	S447P	possibly damaging	Het
Mindy1	G	A	3: 95,295,399	V425M	probably benign	Het
Mllt6	G	A	11: 97,669,500	S210N	possibly damaging	Het
Mrps5	T	A	2: 127,600,852	Y280*	probably null	Het
Muc3a	T	A	5: 137,210,540	T159S	probably damaging	Het
Olfr1252	T	A	2: 89,721,401	T237S	probably damaging	Het
Olfr1310	A	T	2: 112,008,592	M198K	probably damaging	Het
Olfr286	T	A	15: 98,226,761	I295F	probably damaging	Het
Pcdhga4	G	A	18: 37,685,595	V66I	probably benign	Het
Pdhx	T	C	2: 103,041,077	T203A	probably damaging	Het
Pdss1	A	G	2: 22,899,917		probably null	Het
Pdxk	G	T	10: 78,450,307	Q103K	probably benign	Het
Peg3	A	G	7: 6,708,420	C1268R	probably damaging	Het
Pitpnc1	A	T	11: 107,296,267	S77T	probably damaging	Het
Pnisr	T	A	4: 21,874,990		probably benign	Het
Poc1b	C	T	10: 99,107,841	T22I	probably damaging	Het
Ppfia1	G	A	7: 144,506,264	R604W	probably damaging	Het
Ppp1r3a	A	G	6: 14,754,681	F189S	probably damaging	Het
Rbks	T	A	5: 31,650,451	Y99*	probably null	Het
Rsg1	A	G	4: 141,217,385	I82M	probably benign	Het
Sh3rf2	G	T	18: 42,053,924	C36F	probably damaging	Het
Spock3	T	A	8: 63,345,855	N303K	probably damaging	Het
Tcaf2	T	C	6: 42,629,467	T518A	probably benign	Het
Tmem163	A	T	1: 127,500,276	V191D	probably damaging	Het
Trappc6b	A	G	12: 59,050,308	V76A	probably damaging	Het
Ube2nl	A	G	7: 61,549,532		noncoding transcript	Het
Unc5d	C	T	8: 28,694,676	V599M	possibly damaging	Het
Vmn1r184	A	T	7: 26,266,921	M31L	probably benign	Het
Vrtn	C	A	12: 84,649,474	Q333K	probably damaging	Het
Zfp788	T	A	7: 41,648,584	F163I	possibly damaging	Het
Zfyve1	C	T	12: 83,555,647	R458H	probably damaging	Het

Other mutations in Fam208b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Fam208b	APN	13	3574832	missense	probably benign
IGL00670:Fam208b	APN	13	3585241	missense	probably benign	0.14
IGL00957:Fam208b	APN	13	3577101	missense	possibly damaging	0.86
IGL01311:Fam208b	APN	13	3575885	missense	possibly damaging	0.85
IGL01318:Fam208b	APN	13	3575067	missense	possibly damaging	0.66
IGL01767:Fam208b	APN	13	3576633	missense	probably benign	0.00
IGL02073:Fam208b	APN	13	3574721	missense	probably benign	0.01
IGL02152:Fam208b	APN	13	3585371	missense	probably benign
IGL02431:Fam208b	APN	13	3574736	missense	possibly damaging	0.85
IGL02478:Fam208b	APN	13	3574661	missense	probably benign	0.12
IGL02732:Fam208b	APN	13	3573626	missense	probably benign	0.09
IGL02745:Fam208b	APN	13	3585140	missense	probably benign	0.23
IGL02800:Fam208b	APN	13	3585154	missense	probably benign
IGL02989:Fam208b	APN	13	3584820	missense	probably benign	0.01
IGL03124:Fam208b	APN	13	3574704	missense	probably benign	0.41
IGL03154:Fam208b	APN	13	3575255	missense	possibly damaging	0.56
IGL03216:Fam208b	APN	13	3574553	missense	probably damaging	0.98
BB001:Fam208b	UTSW	13	3594331	missense	possibly damaging	0.92
BB011:Fam208b	UTSW	13	3594331	missense	possibly damaging	0.92
H8562:Fam208b	UTSW	13	3577000	missense	probably damaging	0.98
PIT4585001:Fam208b	UTSW	13	3574979	missense	possibly damaging	0.55
R0016:Fam208b	UTSW	13	3585170	splice site	probably null
R0016:Fam208b	UTSW	13	3585170	splice site	probably null
R0157:Fam208b	UTSW	13	3575550	missense	probably benign	0.06
R0375:Fam208b	UTSW	13	3596842	missense	possibly damaging	0.85
R0403:Fam208b	UTSW	13	3582052	nonsense	probably null
R0472:Fam208b	UTSW	13	3588364	missense	possibly damaging	0.93
R0517:Fam208b	UTSW	13	3566964	missense	possibly damaging	0.94
R0586:Fam208b	UTSW	13	3590321	missense	probably damaging	0.99
R0600:Fam208b	UTSW	13	3576054	missense	probably benign
R0659:Fam208b	UTSW	13	3574448	missense	probably damaging	0.99
R1257:Fam208b	UTSW	13	3575049	missense	probably benign	0.25
R1375:Fam208b	UTSW	13	3576029	missense	probably benign	0.06
R1443:Fam208b	UTSW	13	3575543	missense	probably benign	0.00
R1497:Fam208b	UTSW	13	3570409	missense	probably damaging	0.96
R1544:Fam208b	UTSW	13	3590413	missense	possibly damaging	0.68
R1554:Fam208b	UTSW	13	3576374	missense	possibly damaging	0.85
R1629:Fam208b	UTSW	13	3574121	missense	possibly damaging	0.84
R1633:Fam208b	UTSW	13	3581771	missense	possibly damaging	0.53
R1661:Fam208b	UTSW	13	3573860	missense	possibly damaging	0.63
R1673:Fam208b	UTSW	13	3584498	critical splice donor site	probably null
R1675:Fam208b	UTSW	13	3569507	missense	possibly damaging	0.65
R1781:Fam208b	UTSW	13	3584759	missense	possibly damaging	0.95
R1792:Fam208b	UTSW	13	3590559	missense	possibly damaging	0.91
R1826:Fam208b	UTSW	13	3581759	missense	probably damaging	0.98
R1920:Fam208b	UTSW	13	3576612	missense	possibly damaging	0.63
R1983:Fam208b	UTSW	13	3574853	missense	possibly damaging	0.92
R2016:Fam208b	UTSW	13	3576770	missense	probably benign	0.41
R2017:Fam208b	UTSW	13	3576770	missense	probably benign	0.41
R2220:Fam208b	UTSW	13	3581872	missense	probably benign	0.00
R2513:Fam208b	UTSW	13	3582150	missense	possibly damaging	0.53
R2898:Fam208b	UTSW	13	3585122	missense	possibly damaging	0.82
R2904:Fam208b	UTSW	13	3582185	missense	possibly damaging	0.53
R3149:Fam208b	UTSW	13	3574359	missense	probably damaging	0.98
R3623:Fam208b	UTSW	13	3595556	missense	probably benign
R3624:Fam208b	UTSW	13	3595556	missense	probably benign
R3725:Fam208b	UTSW	13	3590538	missense	probably benign	0.33
R3835:Fam208b	UTSW	13	3575292	missense	probably benign	0.01
R3890:Fam208b	UTSW	13	3596785	missense	probably damaging	0.96
R4023:Fam208b	UTSW	13	3584554	missense	probably damaging	0.99
R4024:Fam208b	UTSW	13	3584554	missense	probably damaging	0.99
R4025:Fam208b	UTSW	13	3584554	missense	probably damaging	0.99
R4050:Fam208b	UTSW	13	3573507	missense	probably benign	0.09
R4308:Fam208b	UTSW	13	3569498	missense	probably damaging	0.97
R4484:Fam208b	UTSW	13	3581831	missense	probably benign	0.12
R4674:Fam208b	UTSW	13	3573686	missense	possibly damaging	0.69
R4718:Fam208b	UTSW	13	3574495	missense	probably benign	0.00
R4745:Fam208b	UTSW	13	3590069	missense	probably benign	0.26
R4776:Fam208b	UTSW	13	3570391	missense	probably damaging	1.00
R4839:Fam208b	UTSW	13	3584807	missense	probably damaging	0.96
R4855:Fam208b	UTSW	13	3566680	splice site	probably null
R5049:Fam208b	UTSW	13	3574000	missense	probably benign	0.00
R5287:Fam208b	UTSW	13	3575744	missense	probably benign	0.41
R5298:Fam208b	UTSW	13	3595613	splice site	probably null
R5379:Fam208b	UTSW	13	3588496	missense	probably benign	0.41
R5512:Fam208b	UTSW	13	3595517	missense	probably damaging	0.99
R5624:Fam208b	UTSW	13	3584996	missense	possibly damaging	0.66
R5750:Fam208b	UTSW	13	3573642	nonsense	probably null
R6114:Fam208b	UTSW	13	3590081	missense	probably damaging	1.00
R6118:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6119:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6269:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6270:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6271:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6272:Fam208b	UTSW	13	3581891	missense	possibly damaging	0.76
R6525:Fam208b	UTSW	13	3576540	nonsense	probably null
R6550:Fam208b	UTSW	13	3590519	missense	possibly damaging	0.85
R6714:Fam208b	UTSW	13	3594189	missense	probably benign	0.00
R6797:Fam208b	UTSW	13	3576769	missense	probably benign	0.26
R6967:Fam208b	UTSW	13	3574819	missense	probably benign	0.22
R7016:Fam208b	UTSW	13	3576857	missense	possibly damaging	0.92
R7219:Fam208b	UTSW	13	3590521	missense	probably damaging	0.99
R7454:Fam208b	UTSW	13	3585332	missense	probably benign	0.21
R7570:Fam208b	UTSW	13	3573621	missense	probably damaging	0.99
R7571:Fam208b	UTSW	13	3575292	missense	probably benign	0.01
R7580:Fam208b	UTSW	13	3574752	missense	probably damaging	0.99
R7587:Fam208b	UTSW	13	3568849	missense	possibly damaging	0.83
R7657:Fam208b	UTSW	13	3573777	missense	probably damaging	0.98
R7810:Fam208b	UTSW	13	3575714	missense	possibly damaging	0.61
R7909:Fam208b	UTSW	13	3573765	missense	possibly damaging	0.93
R7924:Fam208b	UTSW	13	3594331	missense	possibly damaging	0.92
R7945:Fam208b	UTSW	13	3576085	missense	probably benign
R8005:Fam208b	UTSW	13	3575681	missense	probably benign
R8067:Fam208b	UTSW	13	3569602	missense	probably benign
R8112:Fam208b	UTSW	13	3569516	missense	probably damaging	1.00
R8162:Fam208b	UTSW	13	3599691	missense	probably damaging	0.96
R8170:Fam208b	UTSW	13	3574881	nonsense	probably null
R8240:Fam208b	UTSW	13	3574388	missense	probably benign
R8263:Fam208b	UTSW	13	3575286	missense	possibly damaging	0.70
R8263:Fam208b	UTSW	13	3590016	missense	probably benign	0.03
R8477:Fam208b	UTSW	13	3575079	missense	probably benign	0.18
R9022:Fam208b	UTSW	13	3576659	missense	probably benign
R9140:Fam208b	UTSW	13	3588441	missense	probably benign	0.04
R9167:Fam208b	UTSW	13	3574724	missense	probably benign
R9527:Fam208b	UTSW	13	3585191	missense	possibly damaging	0.61
R9535:Fam208b	UTSW	13	3573559	missense	possibly damaging	0.69
R9711:Fam208b	UTSW	13	3599667	missense	probably benign
X0024:Fam208b	UTSW	13	3599837	missense	probably null	0.99
X0025:Fam208b	UTSW	13	3576827	missense	probably benign	0.15
X0066:Fam208b	UTSW	13	3588441	missense	probably benign	0.04
Z1176:Fam208b	UTSW	13	3576636	missense	probably benign	0.01
Z1176:Fam208b	UTSW	13	3588429	missense	probably damaging	0.98
Z1177:Fam208b	UTSW	13	3574234	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TCCCTCTTCAGTGAGAGATCAG -3'
(R):5'- AGTAAGTGCCTTTCTGCCTC -3'

Sequencing Primer
(F):5'- GAGAGATCAGTTTGTTTGGGAAATAC -3'
(R):5'- TTACAGAAAGAGATTCCTCCTCTGAC -3'

Posted On

2016-06-21