Incidental Mutation 'R5076:Olfr286'
ID395789
Institutional Source Beutler Lab
Gene Symbol Olfr286
Ensembl Gene ENSMUSG00000059460
Gene Nameolfactory receptor 286
SynonymsMOR286-2, EG629524, GA_x6K02T2NBG7-5528233-5529186
MMRRC Submission 042665-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R5076 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location98224308-98234450 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98226761 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 295 (I295F)
Ref Sequence ENSEMBL: ENSMUSP00000154542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073612] [ENSMUST00000205305]
Predicted Effect probably damaging
Transcript: ENSMUST00000073612
AA Change: I297F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073296
Gene: ENSMUSG00000059460
AA Change: I297F

DomainStartEndE-ValueType
Pfam:7tm_4 37 313 2.6e-52 PFAM
Pfam:7tm_1 47 296 2.4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000073612
AA Change: I297F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000205305
AA Change: I295F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206621
Meta Mutation Damage Score 0.4307 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 90,056,252 I72V probably benign Het
Aadacl3 G A 4: 144,456,070 P276L possibly damaging Het
Acp6 T A 3: 97,167,989 S180T probably benign Het
Adgrd1 A T 5: 129,143,989 R449* probably null Het
Ak1 T C 2: 32,633,448 V176A probably damaging Het
Capzb A T 4: 139,287,814 D226V possibly damaging Het
Cd34 A T 1: 194,948,030 probably benign Het
Cdh15 C A 8: 122,864,348 D445E possibly damaging Het
Chil4 A G 3: 106,202,597 F367L probably damaging Het
Clstn2 T C 9: 97,483,079 Y458C probably damaging Het
Ctsw T C 19: 5,468,458 Y9C probably benign Het
Dhrs7 T C 12: 72,659,481 D50G probably benign Het
Dnah14 A G 1: 181,757,234 K3177E probably benign Het
Ehd1 T C 19: 6,277,221 F83L probably benign Het
Eif5a2 G A 3: 28,782,737 V59I possibly damaging Het
Emilin3 T A 2: 160,909,318 probably null Het
Entpd8 A G 2: 25,085,054 S426G possibly damaging Het
Epb41l4b C T 4: 57,040,984 G493D probably damaging Het
Fam208b C T 13: 3,576,357 V1198I probably benign Het
Gm11596 C T 11: 99,792,872 G141R unknown Het
Gm1840 T G 8: 5,640,130 noncoding transcript Het
H2-Q4 T C 17: 35,380,441 Y167H probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Itpr1 A G 6: 108,405,529 probably null Het
Kif2c A T 4: 117,174,869 probably benign Het
Klrb1-ps1 C T 6: 129,119,788 noncoding transcript Het
Krtap9-5 A T 11: 99,949,468 T332S unknown Het
Lrrc39 A T 3: 116,579,540 E283V probably benign Het
Mdga1 A G 17: 29,850,554 S447P possibly damaging Het
Mindy1 G A 3: 95,295,399 V425M probably benign Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Muc3a T A 5: 137,210,540 T159S probably damaging Het
Olfr1252 T A 2: 89,721,401 T237S probably damaging Het
Olfr1310 A T 2: 112,008,592 M198K probably damaging Het
Pcdhga4 G A 18: 37,685,595 V66I probably benign Het
Pdhx T C 2: 103,041,077 T203A probably damaging Het
Pdss1 A G 2: 22,899,917 probably null Het
Pdxk G T 10: 78,450,307 Q103K probably benign Het
Peg3 A G 7: 6,708,420 C1268R probably damaging Het
Pitpnc1 A T 11: 107,296,267 S77T probably damaging Het
Pnisr T A 4: 21,874,990 probably benign Het
Poc1b C T 10: 99,107,841 T22I probably damaging Het
Ppfia1 G A 7: 144,506,264 R604W probably damaging Het
Ppp1r3a A G 6: 14,754,681 F189S probably damaging Het
Rbks T A 5: 31,650,451 Y99* probably null Het
Rsg1 A G 4: 141,217,385 I82M probably benign Het
Sh3rf2 G T 18: 42,053,924 C36F probably damaging Het
Spock3 T A 8: 63,345,855 N303K probably damaging Het
Tcaf2 T C 6: 42,629,467 T518A probably benign Het
Tmem163 A T 1: 127,500,276 V191D probably damaging Het
Trappc6b A G 12: 59,050,308 V76A probably damaging Het
Ube2nl A G 7: 61,549,532 noncoding transcript Het
Unc5d C T 8: 28,694,676 V599M possibly damaging Het
Vmn1r184 A T 7: 26,266,921 M31L probably benign Het
Vrtn C A 12: 84,649,474 Q333K probably damaging Het
Zfp788 T A 7: 41,648,584 F163I possibly damaging Het
Zfyve1 C T 12: 83,555,647 R458H probably damaging Het
Other mutations in Olfr286
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02436:Olfr286 APN 15 98227290 nonsense probably null
IGL02850:Olfr286 APN 15 98227351 missense probably benign 0.01
R1833:Olfr286 UTSW 15 98226965 missense probably damaging 1.00
R3879:Olfr286 UTSW 15 98227204 missense probably damaging 0.98
R4854:Olfr286 UTSW 15 98227544 missense possibly damaging 0.93
R4866:Olfr286 UTSW 15 98227490 missense probably damaging 1.00
R5886:Olfr286 UTSW 15 98226791 missense possibly damaging 0.83
R7090:Olfr286 UTSW 15 98227202 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAATGTCTTTCTTGGAGCCCTC -3'
(R):5'- AGTCCCATGGTGCTCATTGTC -3'

Sequencing Primer
(F):5'- CCCTCCAGCATTGGGAATAAAGG -3'
(R):5'- ATGGTGCTCATTGTCACTTCCTATG -3'
Posted On2016-06-21