Incidental Mutation 'R5076:Mdga1'
ID 395790
Institutional Source Beutler Lab
Gene Symbol Mdga1
Ensembl Gene ENSMUSG00000043557
Gene Name MAM domain containing glycosylphosphatidylinositol anchor 1
Synonyms Mamdc3, 1200011I03Rik
MMRRC Submission 042665-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.362) question?
Stock # R5076 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 30046930-30107557 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30069528 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 447 (S447P)
Ref Sequence ENSEMBL: ENSMUSP00000130395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073556] [ENSMUST00000165211] [ENSMUST00000167190] [ENSMUST00000171691]
AlphaFold Q0PMG2
Predicted Effect probably benign
Transcript: ENSMUST00000073556
AA Change: S173P

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073246
Gene: ENSMUSG00000043557
AA Change: S173P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG 142 236 3.2e-2 SMART
IGc2 253 315 6.25e-14 SMART
IGc2 348 422 3.54e-4 SMART
IGc2 454 521 6.55e-8 SMART
IGc2 551 623 9.49e-5 SMART
FN3 642 731 2.05e0 SMART
MAM 741 911 1.02e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165211
AA Change: S173P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000132583
Gene: ENSMUSG00000043557
AA Change: S173P

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG_like 148 221 6.07e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167102
Predicted Effect possibly damaging
Transcript: ENSMUST00000167190
AA Change: S447P

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130395
Gene: ENSMUSG00000043557
AA Change: S447P

DomainStartEndE-ValueType
low complexity region 236 246 N/A INTRINSIC
low complexity region 251 265 N/A INTRINSIC
IGc2 325 389 1.62e-12 SMART
IG 416 510 3.2e-2 SMART
IGc2 527 589 6.25e-14 SMART
IGc2 622 696 3.54e-4 SMART
IGc2 728 795 6.55e-8 SMART
IGc2 825 897 9.49e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171691
AA Change: S173P

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126529
Gene: ENSMUSG00000043557
AA Change: S173P

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IGc2 51 115 1.62e-12 SMART
IG 142 236 3.2e-2 SMART
IGc2 253 315 6.25e-14 SMART
IGc2 348 422 3.54e-4 SMART
IGc2 454 521 6.55e-8 SMART
IGc2 551 623 9.49e-5 SMART
FN3 642 731 2.05e0 SMART
MAM 749 919 3.61e-53 SMART
Meta Mutation Damage Score 0.4232 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylphosphatidylinositol (GPI)-anchored cell surface glycoprotein that is expressed predominantly in the developing nervous system. In addition to possessing several cell adhesion molecule-like domains, the mature protein has six Ig-like domains, a single fibronectin type III domain, a MAM domain and a C-terminal GPI-anchoring site. Studies in other mammals suggest this protein plays a role in cell adhesion, migration, and axon guidance and, in the developing brain, neuronal migration. In humans, this gene is associated with bipolar disorder and schizophrenia. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuronal migration during corticogenesis that is resolved by P7 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 89,963,559 (GRCm39) I72V probably benign Het
Aadacl3 G A 4: 144,182,640 (GRCm39) P276L possibly damaging Het
Acp6 T A 3: 97,075,305 (GRCm39) S180T probably benign Het
Adgrd1 A T 5: 129,221,053 (GRCm39) R449* probably null Het
Ak1 T C 2: 32,523,460 (GRCm39) V176A probably damaging Het
Capzb A T 4: 139,015,125 (GRCm39) D226V possibly damaging Het
Cd34 A T 1: 194,630,338 (GRCm39) probably benign Het
Cdh15 C A 8: 123,591,087 (GRCm39) D445E possibly damaging Het
Chil4 A G 3: 106,109,913 (GRCm39) F367L probably damaging Het
Clstn2 T C 9: 97,365,132 (GRCm39) Y458C probably damaging Het
Cplane2 A G 4: 140,944,696 (GRCm39) I82M probably benign Het
Ctsw T C 19: 5,518,486 (GRCm39) Y9C probably benign Het
Dhrs7 T C 12: 72,706,255 (GRCm39) D50G probably benign Het
Dnah14 A G 1: 181,584,799 (GRCm39) K3177E probably benign Het
Ehd1 T C 19: 6,327,251 (GRCm39) F83L probably benign Het
Eif5a2 G A 3: 28,836,886 (GRCm39) V59I possibly damaging Het
Emilin3 T A 2: 160,751,238 (GRCm39) probably null Het
Entpd8 A G 2: 24,975,066 (GRCm39) S426G possibly damaging Het
Epb41l4b C T 4: 57,040,984 (GRCm39) G493D probably damaging Het
Gm11596 C T 11: 99,683,698 (GRCm39) G141R unknown Het
Gpi-ps T G 8: 5,690,130 (GRCm39) noncoding transcript Het
H2-Q4 T C 17: 35,599,417 (GRCm39) Y167H probably damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Itpr1 A G 6: 108,382,490 (GRCm39) probably null Het
Kif2c A T 4: 117,032,066 (GRCm39) probably benign Het
Klrb1-ps1 C T 6: 129,096,751 (GRCm39) noncoding transcript Het
Krtap9-5 A T 11: 99,840,294 (GRCm39) T332S unknown Het
Lrrc39 A T 3: 116,373,189 (GRCm39) E283V probably benign Het
Mindy1 G A 3: 95,202,710 (GRCm39) V425M probably benign Het
Mllt6 G A 11: 97,560,326 (GRCm39) S210N possibly damaging Het
Mrps5 T A 2: 127,442,772 (GRCm39) Y280* probably null Het
Muc3a T A 5: 137,244,997 (GRCm39) T159S probably damaging Het
Or10ad1b T A 15: 98,124,642 (GRCm39) I295F probably damaging Het
Or4a79 T A 2: 89,551,745 (GRCm39) T237S probably damaging Het
Or4f6 A T 2: 111,838,937 (GRCm39) M198K probably damaging Het
Pcdhga4 G A 18: 37,818,648 (GRCm39) V66I probably benign Het
Pdhx T C 2: 102,871,422 (GRCm39) T203A probably damaging Het
Pdss1 A G 2: 22,789,929 (GRCm39) probably null Het
Pdxk G T 10: 78,286,141 (GRCm39) Q103K probably benign Het
Peg3 A G 7: 6,711,419 (GRCm39) C1268R probably damaging Het
Pitpnc1 A T 11: 107,187,093 (GRCm39) S77T probably damaging Het
Pnisr T A 4: 21,874,990 (GRCm39) probably benign Het
Poc1b C T 10: 98,943,703 (GRCm39) T22I probably damaging Het
Ppfia1 G A 7: 144,060,001 (GRCm39) R604W probably damaging Het
Ppp1r3a A G 6: 14,754,680 (GRCm39) F189S probably damaging Het
Rbks T A 5: 31,807,795 (GRCm39) Y99* probably null Het
Sh3rf2 G T 18: 42,186,989 (GRCm39) C36F probably damaging Het
Spock3 T A 8: 63,798,889 (GRCm39) N303K probably damaging Het
Tasor2 C T 13: 3,626,357 (GRCm39) V1198I probably benign Het
Tcaf2 T C 6: 42,606,401 (GRCm39) T518A probably benign Het
Tmem163 A T 1: 127,428,013 (GRCm39) V191D probably damaging Het
Trappc6b A G 12: 59,097,094 (GRCm39) V76A probably damaging Het
Ube2nl A G 7: 61,199,280 (GRCm39) noncoding transcript Het
Unc5d C T 8: 29,184,704 (GRCm39) V599M possibly damaging Het
Vmn1r184 A T 7: 25,966,346 (GRCm39) M31L probably benign Het
Vrtn C A 12: 84,696,248 (GRCm39) Q333K probably damaging Het
Zfp788 T A 7: 41,298,008 (GRCm39) F163I possibly damaging Het
Zfyve1 C T 12: 83,602,421 (GRCm39) R458H probably damaging Het
Other mutations in Mdga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Mdga1 APN 17 30,062,101 (GRCm39) missense possibly damaging 0.50
IGL01637:Mdga1 APN 17 30,058,845 (GRCm39) missense probably damaging 1.00
IGL02130:Mdga1 APN 17 30,076,643 (GRCm39) missense possibly damaging 0.96
IGL02596:Mdga1 APN 17 30,051,379 (GRCm39) splice site probably benign
IGL03258:Mdga1 APN 17 30,058,887 (GRCm39) missense probably damaging 1.00
R0184:Mdga1 UTSW 17 30,071,416 (GRCm39) missense probably damaging 1.00
R0366:Mdga1 UTSW 17 30,076,682 (GRCm39) missense possibly damaging 0.85
R1017:Mdga1 UTSW 17 30,069,522 (GRCm39) missense probably damaging 0.98
R1520:Mdga1 UTSW 17 30,065,493 (GRCm39) missense probably benign 0.12
R1545:Mdga1 UTSW 17 30,061,876 (GRCm39) missense probably damaging 1.00
R1549:Mdga1 UTSW 17 30,056,972 (GRCm39) missense probably damaging 1.00
R1671:Mdga1 UTSW 17 30,069,603 (GRCm39) missense probably damaging 1.00
R1875:Mdga1 UTSW 17 30,071,581 (GRCm39) missense probably damaging 1.00
R1893:Mdga1 UTSW 17 30,068,200 (GRCm39) missense probably damaging 1.00
R1958:Mdga1 UTSW 17 30,059,862 (GRCm39) missense probably damaging 1.00
R1983:Mdga1 UTSW 17 30,069,579 (GRCm39) missense probably damaging 1.00
R2014:Mdga1 UTSW 17 30,068,287 (GRCm39) missense probably damaging 1.00
R2894:Mdga1 UTSW 17 30,071,478 (GRCm39) missense probably damaging 1.00
R2964:Mdga1 UTSW 17 30,071,442 (GRCm39) missense probably damaging 1.00
R3813:Mdga1 UTSW 17 30,057,453 (GRCm39) missense probably damaging 1.00
R3938:Mdga1 UTSW 17 30,076,596 (GRCm39) missense probably damaging 1.00
R3982:Mdga1 UTSW 17 30,150,238 (GRCm39) missense unknown
R4063:Mdga1 UTSW 17 30,057,005 (GRCm39) missense probably damaging 1.00
R4157:Mdga1 UTSW 17 30,052,317 (GRCm39) missense probably benign 0.32
R4183:Mdga1 UTSW 17 30,188,964 (GRCm39) missense unknown
R4392:Mdga1 UTSW 17 30,069,630 (GRCm39) missense probably damaging 1.00
R4393:Mdga1 UTSW 17 30,069,491 (GRCm39) missense probably damaging 1.00
R4396:Mdga1 UTSW 17 30,069,491 (GRCm39) missense probably damaging 1.00
R4806:Mdga1 UTSW 17 30,061,128 (GRCm39) missense probably benign 0.20
R4829:Mdga1 UTSW 17 30,065,343 (GRCm39) missense possibly damaging 0.91
R4923:Mdga1 UTSW 17 30,057,052 (GRCm39) missense probably damaging 0.99
R4932:Mdga1 UTSW 17 30,076,580 (GRCm39) missense probably damaging 1.00
R5015:Mdga1 UTSW 17 30,058,847 (GRCm39) missense possibly damaging 0.71
R5141:Mdga1 UTSW 17 30,071,467 (GRCm39) missense probably benign 0.43
R5180:Mdga1 UTSW 17 30,076,710 (GRCm39) splice site probably benign
R5590:Mdga1 UTSW 17 30,058,841 (GRCm39) missense probably damaging 1.00
R5747:Mdga1 UTSW 17 30,069,525 (GRCm39) missense probably benign 0.11
R5748:Mdga1 UTSW 17 30,069,525 (GRCm39) missense probably benign 0.11
R6207:Mdga1 UTSW 17 30,057,491 (GRCm39) missense probably damaging 1.00
R6826:Mdga1 UTSW 17 30,189,000 (GRCm39) missense unknown
R6831:Mdga1 UTSW 17 30,106,490 (GRCm39) nonsense probably null
R7114:Mdga1 UTSW 17 30,061,816 (GRCm39) splice site probably null
R7147:Mdga1 UTSW 17 30,065,495 (GRCm39) nonsense probably null
R7273:Mdga1 UTSW 17 30,188,912 (GRCm39) missense unknown
R7413:Mdga1 UTSW 17 30,069,647 (GRCm39) missense probably damaging 1.00
R7637:Mdga1 UTSW 17 30,051,353 (GRCm39) missense probably benign 0.00
R7797:Mdga1 UTSW 17 30,061,814 (GRCm39) splice site probably null
R7812:Mdga1 UTSW 17 30,062,115 (GRCm39) missense probably benign 0.02
R7838:Mdga1 UTSW 17 30,058,796 (GRCm39) missense probably benign 0.10
R8463:Mdga1 UTSW 17 30,068,703 (GRCm39) missense probably damaging 1.00
R8697:Mdga1 UTSW 17 30,065,615 (GRCm39) missense probably damaging 0.97
R8699:Mdga1 UTSW 17 30,061,348 (GRCm39) missense possibly damaging 0.87
R8864:Mdga1 UTSW 17 30,150,295 (GRCm39) missense unknown
R8945:Mdga1 UTSW 17 30,058,959 (GRCm39) splice site probably benign
R9150:Mdga1 UTSW 17 30,057,420 (GRCm39) missense probably damaging 0.98
R9157:Mdga1 UTSW 17 30,057,491 (GRCm39) missense probably damaging 1.00
R9294:Mdga1 UTSW 17 30,058,871 (GRCm39) missense probably damaging 1.00
R9301:Mdga1 UTSW 17 30,069,512 (GRCm39) missense probably benign 0.31
R9367:Mdga1 UTSW 17 30,051,282 (GRCm39) makesense probably null
R9567:Mdga1 UTSW 17 30,076,569 (GRCm39) missense probably damaging 1.00
R9665:Mdga1 UTSW 17 30,051,991 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTTACCCCAAGCTGTGTGAAC -3'
(R):5'- ACTTCGTCTTGACTTAGGGCTG -3'

Sequencing Primer
(F):5'- GATGATGTCAGACCAGTCTCC -3'
(R):5'- GCTGGTGTCCTTGCAGAC -3'
Posted On 2016-06-21