Incidental Mutation 'R5076:Pcdhga4'
ID395792
Institutional Source Beutler Lab
Gene Symbol Pcdhga4
Ensembl Gene ENSMUSG00000103677
Gene Nameprotocadherin gamma subfamily A, 4
Synonyms
MMRRC Submission 042665-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R5076 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37685210-37841873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37685595 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 66 (V66I)
Ref Sequence ENSEMBL: ENSMUSP00000142140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073447] [ENSMUST00000115661] [ENSMUST00000192931] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000194544] [ENSMUST00000195112]
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193631
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
AA Change: V66I

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677
AA Change: V66I

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195624
Meta Mutation Damage Score 0.0896 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 90,056,252 I72V probably benign Het
Aadacl3 G A 4: 144,456,070 P276L possibly damaging Het
Acp6 T A 3: 97,167,989 S180T probably benign Het
Adgrd1 A T 5: 129,143,989 R449* probably null Het
Ak1 T C 2: 32,633,448 V176A probably damaging Het
Capzb A T 4: 139,287,814 D226V possibly damaging Het
Cd34 A T 1: 194,948,030 probably benign Het
Cdh15 C A 8: 122,864,348 D445E possibly damaging Het
Chil4 A G 3: 106,202,597 F367L probably damaging Het
Clstn2 T C 9: 97,483,079 Y458C probably damaging Het
Ctsw T C 19: 5,468,458 Y9C probably benign Het
Dhrs7 T C 12: 72,659,481 D50G probably benign Het
Dnah14 A G 1: 181,757,234 K3177E probably benign Het
Ehd1 T C 19: 6,277,221 F83L probably benign Het
Eif5a2 G A 3: 28,782,737 V59I possibly damaging Het
Emilin3 T A 2: 160,909,318 probably null Het
Entpd8 A G 2: 25,085,054 S426G possibly damaging Het
Epb41l4b C T 4: 57,040,984 G493D probably damaging Het
Fam208b C T 13: 3,576,357 V1198I probably benign Het
Gm11596 C T 11: 99,792,872 G141R unknown Het
Gm1840 T G 8: 5,640,130 noncoding transcript Het
H2-Q4 T C 17: 35,380,441 Y167H probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Itpr1 A G 6: 108,405,529 probably null Het
Kif2c A T 4: 117,174,869 probably benign Het
Klrb1-ps1 C T 6: 129,119,788 noncoding transcript Het
Krtap9-5 A T 11: 99,949,468 T332S unknown Het
Lrrc39 A T 3: 116,579,540 E283V probably benign Het
Mdga1 A G 17: 29,850,554 S447P possibly damaging Het
Mindy1 G A 3: 95,295,399 V425M probably benign Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Muc3a T A 5: 137,210,540 T159S probably damaging Het
Olfr1252 T A 2: 89,721,401 T237S probably damaging Het
Olfr1310 A T 2: 112,008,592 M198K probably damaging Het
Olfr286 T A 15: 98,226,761 I295F probably damaging Het
Pdhx T C 2: 103,041,077 T203A probably damaging Het
Pdss1 A G 2: 22,899,917 probably null Het
Pdxk G T 10: 78,450,307 Q103K probably benign Het
Peg3 A G 7: 6,708,420 C1268R probably damaging Het
Pitpnc1 A T 11: 107,296,267 S77T probably damaging Het
Pnisr T A 4: 21,874,990 probably benign Het
Poc1b C T 10: 99,107,841 T22I probably damaging Het
Ppfia1 G A 7: 144,506,264 R604W probably damaging Het
Ppp1r3a A G 6: 14,754,681 F189S probably damaging Het
Rbks T A 5: 31,650,451 Y99* probably null Het
Rsg1 A G 4: 141,217,385 I82M probably benign Het
Sh3rf2 G T 18: 42,053,924 C36F probably damaging Het
Spock3 T A 8: 63,345,855 N303K probably damaging Het
Tcaf2 T C 6: 42,629,467 T518A probably benign Het
Tmem163 A T 1: 127,500,276 V191D probably damaging Het
Trappc6b A G 12: 59,050,308 V76A probably damaging Het
Ube2nl A G 7: 61,549,532 noncoding transcript Het
Unc5d C T 8: 28,694,676 V599M possibly damaging Het
Vmn1r184 A T 7: 26,266,921 M31L probably benign Het
Vrtn C A 12: 84,649,474 Q333K probably damaging Het
Zfp788 T A 7: 41,648,584 F163I possibly damaging Het
Zfyve1 C T 12: 83,555,647 R458H probably damaging Het
Other mutations in Pcdhga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT1430001:Pcdhga4 UTSW 18 37686214 missense probably benign 0.00
R3828:Pcdhga4 UTSW 18 37687601 missense possibly damaging 0.62
R3970:Pcdhga4 UTSW 18 37687601 missense possibly damaging 0.62
R4080:Pcdhga4 UTSW 18 37685779 missense probably damaging 1.00
R4356:Pcdhga4 UTSW 18 37687611 missense probably damaging 1.00
R4834:Pcdhga4 UTSW 18 37685437 missense probably benign 0.01
R4983:Pcdhga4 UTSW 18 37686519 missense probably damaging 1.00
R5186:Pcdhga4 UTSW 18 37687426 missense probably benign 0.07
R5194:Pcdhga4 UTSW 18 37687741 missense probably benign 0.08
R5326:Pcdhga4 UTSW 18 37686598 missense probably damaging 0.98
R5333:Pcdhga4 UTSW 18 37685424 missense probably benign 0.00
R5373:Pcdhga4 UTSW 18 37685596 missense probably damaging 1.00
R5374:Pcdhga4 UTSW 18 37685596 missense probably damaging 1.00
R5419:Pcdhga4 UTSW 18 37686745 missense probably damaging 1.00
R5542:Pcdhga4 UTSW 18 37686598 missense probably damaging 0.98
R5878:Pcdhga4 UTSW 18 37687686 missense probably benign 0.03
R5996:Pcdhga4 UTSW 18 37685938 missense probably benign 0.03
R6056:Pcdhga4 UTSW 18 37686330 missense probably benign 0.00
R6083:Pcdhga4 UTSW 18 37687425 missense probably damaging 0.98
R6155:Pcdhga4 UTSW 18 37686493 missense probably damaging 0.98
R6208:Pcdhga4 UTSW 18 37686709 missense probably damaging 1.00
R6306:Pcdhga4 UTSW 18 37685913 missense probably damaging 1.00
R6580:Pcdhga4 UTSW 18 37687317 missense possibly damaging 0.93
R6936:Pcdhga4 UTSW 18 37687405 missense possibly damaging 0.84
R7132:Pcdhga4 UTSW 18 37687377 missense probably damaging 1.00
R7159:Pcdhga4 UTSW 18 37686919 missense probably damaging 1.00
R7257:Pcdhga4 UTSW 18 37687398 missense probably damaging 0.99
R7263:Pcdhga4 UTSW 18 37686820 missense probably benign 0.42
R7825:Pcdhga4 UTSW 18 37687321 missense probably damaging 1.00
R7882:Pcdhga4 UTSW 18 37686628 missense probably damaging 1.00
R7916:Pcdhga4 UTSW 18 37685449 missense probably benign 0.22
R8053:Pcdhga4 UTSW 18 37686255 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCGGCTCCTTACAAATCAGAC -3'
(R):5'- CTCTCTGCTGTGCTCCAAAG -3'

Sequencing Primer
(F):5'- GCTCCTTACAAATCAGACCGCAG -3'
(R):5'- TCCAAAGCTGGGGGCATTATC -3'
Posted On2016-06-21