Incidental Mutation 'R5076:Ehd1'
ID 395795
Institutional Source Beutler Lab
Gene Symbol Ehd1
Ensembl Gene ENSMUSG00000024772
Gene Name EH-domain containing 1
Synonyms RME-1, Past1
MMRRC Submission 042665-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5076 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 6276725-6300096 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6277221 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 83 (F83L)
Ref Sequence ENSEMBL: ENSMUSP00000025684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025684]
AlphaFold Q9WVK4
Predicted Effect probably benign
Transcript: ENSMUST00000025684
AA Change: F83L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000025684
Gene: ENSMUSG00000024772
AA Change: F83L

DomainStartEndE-ValueType
Pfam:EHD_N 24 56 1.2e-19 PFAM
Pfam:MMR_HSR1 60 220 5.1e-9 PFAM
Pfam:Dynamin_N 61 221 6.6e-15 PFAM
low complexity region 420 433 N/A INTRINSIC
EH 438 531 1.82e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165797
Meta Mutation Damage Score 0.2054 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a highly conserved gene family encoding EPS15 homology (EH) domain-containing proteins. The protein-binding EH domain was first noted in EPS15, a substrate for the epidermal growth factor receptor. The EH domain has been shown to be an important motif in proteins involved in protein-protein interactions and in intracellular sorting. The protein encoded by this gene is thought to play a role in the endocytosis of IGF1 receptors. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show perinatal and postnatal lethality, decreased body weight, and male infertility due to defective spermatogenesis; female homozygotes may display malocclusion and variable ocular defects, including congenital central cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik A G 3: 90,056,252 I72V probably benign Het
Aadacl3 G A 4: 144,456,070 P276L possibly damaging Het
Acp6 T A 3: 97,167,989 S180T probably benign Het
Adgrd1 A T 5: 129,143,989 R449* probably null Het
Ak1 T C 2: 32,633,448 V176A probably damaging Het
Capzb A T 4: 139,287,814 D226V possibly damaging Het
Cd34 A T 1: 194,948,030 probably benign Het
Cdh15 C A 8: 122,864,348 D445E possibly damaging Het
Chil4 A G 3: 106,202,597 F367L probably damaging Het
Clstn2 T C 9: 97,483,079 Y458C probably damaging Het
Ctsw T C 19: 5,468,458 Y9C probably benign Het
Dhrs7 T C 12: 72,659,481 D50G probably benign Het
Dnah14 A G 1: 181,757,234 K3177E probably benign Het
Eif5a2 G A 3: 28,782,737 V59I possibly damaging Het
Emilin3 T A 2: 160,909,318 probably null Het
Entpd8 A G 2: 25,085,054 S426G possibly damaging Het
Epb41l4b C T 4: 57,040,984 G493D probably damaging Het
Fam208b C T 13: 3,576,357 V1198I probably benign Het
Gm11596 C T 11: 99,792,872 G141R unknown Het
Gm1840 T G 8: 5,640,130 noncoding transcript Het
H2-Q4 T C 17: 35,380,441 Y167H probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Itpr1 A G 6: 108,405,529 probably null Het
Kif2c A T 4: 117,174,869 probably benign Het
Klrb1-ps1 C T 6: 129,119,788 noncoding transcript Het
Krtap9-5 A T 11: 99,949,468 T332S unknown Het
Lrrc39 A T 3: 116,579,540 E283V probably benign Het
Mdga1 A G 17: 29,850,554 S447P possibly damaging Het
Mindy1 G A 3: 95,295,399 V425M probably benign Het
Mllt6 G A 11: 97,669,500 S210N possibly damaging Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Muc3a T A 5: 137,210,540 T159S probably damaging Het
Olfr1252 T A 2: 89,721,401 T237S probably damaging Het
Olfr1310 A T 2: 112,008,592 M198K probably damaging Het
Olfr286 T A 15: 98,226,761 I295F probably damaging Het
Pcdhga4 G A 18: 37,685,595 V66I probably benign Het
Pdhx T C 2: 103,041,077 T203A probably damaging Het
Pdss1 A G 2: 22,899,917 probably null Het
Pdxk G T 10: 78,450,307 Q103K probably benign Het
Peg3 A G 7: 6,708,420 C1268R probably damaging Het
Pitpnc1 A T 11: 107,296,267 S77T probably damaging Het
Pnisr T A 4: 21,874,990 probably benign Het
Poc1b C T 10: 99,107,841 T22I probably damaging Het
Ppfia1 G A 7: 144,506,264 R604W probably damaging Het
Ppp1r3a A G 6: 14,754,681 F189S probably damaging Het
Rbks T A 5: 31,650,451 Y99* probably null Het
Rsg1 A G 4: 141,217,385 I82M probably benign Het
Sh3rf2 G T 18: 42,053,924 C36F probably damaging Het
Spock3 T A 8: 63,345,855 N303K probably damaging Het
Tcaf2 T C 6: 42,629,467 T518A probably benign Het
Tmem163 A T 1: 127,500,276 V191D probably damaging Het
Trappc6b A G 12: 59,050,308 V76A probably damaging Het
Ube2nl A G 7: 61,549,532 noncoding transcript Het
Unc5d C T 8: 28,694,676 V599M possibly damaging Het
Vmn1r184 A T 7: 26,266,921 M31L probably benign Het
Vrtn C A 12: 84,649,474 Q333K probably damaging Het
Zfp788 T A 7: 41,648,584 F163I possibly damaging Het
Zfyve1 C T 12: 83,555,647 R458H probably damaging Het
Other mutations in Ehd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ehd1 APN 19 6298147 missense possibly damaging 0.86
IGL02573:Ehd1 APN 19 6294300 missense probably damaging 1.00
IGL03146:Ehd1 APN 19 6277338 missense probably damaging 1.00
declining UTSW 19 6294388 missense probably damaging 1.00
R1376:Ehd1 UTSW 19 6294388 missense probably damaging 1.00
R1376:Ehd1 UTSW 19 6294388 missense probably damaging 1.00
R1593:Ehd1 UTSW 19 6298300 missense
R2062:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2064:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2065:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2066:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2067:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2068:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2217:Ehd1 UTSW 19 6298472 missense probably damaging 1.00
R3436:Ehd1 UTSW 19 6277014 nonsense probably null
R3705:Ehd1 UTSW 19 6298300 missense
R4654:Ehd1 UTSW 19 6276964 utr 5 prime probably benign
R4902:Ehd1 UTSW 19 6294243 missense possibly damaging 0.91
R5001:Ehd1 UTSW 19 6297694 missense probably benign 0.14
R6327:Ehd1 UTSW 19 6298345 missense possibly damaging 0.81
R6679:Ehd1 UTSW 19 6294444 missense probably benign 0.01
R7120:Ehd1 UTSW 19 6297561 missense probably benign 0.00
R7183:Ehd1 UTSW 19 6297654 missense probably benign 0.02
R7215:Ehd1 UTSW 19 6297642 missense possibly damaging 0.81
R7853:Ehd1 UTSW 19 6277195 missense probably damaging 0.99
R8467:Ehd1 UTSW 19 6281288 missense probably benign 0.24
R8523:Ehd1 UTSW 19 6294583 missense probably damaging 0.98
R8879:Ehd1 UTSW 19 6298324 missense probably damaging 0.97
R8957:Ehd1 UTSW 19 6294409 missense probably damaging 1.00
R9011:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R9664:Ehd1 UTSW 19 6281232 missense probably benign 0.01
R9687:Ehd1 UTSW 19 6298300 missense
Predicted Primers PCR Primer
(F):5'- TCTCCGGCATCATGTTCAG -3'
(R):5'- TTAGTGGGACGCAGCAAAGC -3'

Sequencing Primer
(F):5'- CGGCATCATGTTCAGCTGGG -3'
(R):5'- CGGAGGCCTTTGGTATCCTC -3'
Posted On 2016-06-21