Incidental Mutation 'R5095:Zdbf2'
ID 395798
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Name zinc finger, DBF-type containing 2
Synonyms 4930431J08Rik, 9330107J05Rik
MMRRC Submission 042684-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R5095 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 63273265-63314576 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 63309073 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 2204 (T2204A)
Ref Sequence ENSEMBL: ENSMUSP00000109767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
AlphaFold Q5SS00
Predicted Effect possibly damaging
Transcript: ENSMUST00000029025
AA Change: T2204A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: T2204A

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114132
AA Change: T2204A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: T2204A

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021A07Rik G C 10: 21,425,593 noncoding transcript Het
4932415D10Rik G T 10: 82,283,667 A4503E probably damaging Het
Adgrv1 C T 13: 81,095,487 V6265I probably benign Het
Agbl1 G A 7: 76,720,133 G660D probably damaging Het
Arap2 A G 5: 62,654,049 Y1140H probably damaging Het
Atp6v1c1 T C 15: 38,679,413 probably null Het
C1rb A T 6: 124,580,313 R470W possibly damaging Het
Caskin2 T C 11: 115,800,738 T1074A probably benign Het
Cdh19 T A 1: 110,954,661 T34S probably benign Het
Csnk1a1 T A 18: 61,575,476 Y175N probably damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Flt4 T A 11: 49,627,159 V342D possibly damaging Het
Frmd5 A T 2: 121,548,921 C394S possibly damaging Het
Gm5414 T G 15: 101,624,038 N550T probably benign Het
Hcn3 C A 3: 89,149,923 R456L probably damaging Het
Htt T C 5: 34,824,395 V893A possibly damaging Het
Ift46 A G 9: 44,786,849 D203G probably damaging Het
Itga10 G T 3: 96,648,164 V145L probably benign Het
Kcnh6 A G 11: 106,017,254 D232G possibly damaging Het
Mbtd1 T C 11: 93,929,671 S431P probably damaging Het
Mmp27 T A 9: 7,572,158 W120R probably damaging Het
Mmp27 A T 9: 7,579,000 D418V probably damaging Het
Myo5a A G 9: 75,152,020 D510G probably damaging Het
Myo5a A T 9: 75,184,389 K1179* probably null Het
Neto1 T C 18: 86,398,281 S38P probably benign Het
Nos3 A G 5: 24,368,918 probably benign Het
Nuggc C T 14: 65,635,090 R512* probably null Het
Oas1e T A 5: 120,794,264 K105* probably null Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr512 T C 7: 108,713,812 F141S probably damaging Het
Omd T A 13: 49,589,698 S75T possibly damaging Het
Pbrm1 A G 14: 31,032,530 N190S probably benign Het
Picalm T C 7: 90,170,633 F85L probably damaging Het
Polg A G 7: 79,460,300 V360A possibly damaging Het
Prex1 T C 2: 166,581,921 D1017G probably damaging Het
Prss56 G C 1: 87,188,111 R569P probably damaging Het
Rab6b G A 9: 103,140,384 G25R probably damaging Het
Rdh10 A G 1: 16,131,385 T332A probably benign Het
Rheb A T 5: 24,807,641 M115K probably benign Het
Rnf149 A T 1: 39,555,656 D321E probably benign Het
Rps28 C T 17: 33,823,203 probably null Het
Slc6a20b A G 9: 123,595,054 V616A probably benign Het
Smarcc2 A G 10: 128,469,300 K300R probably damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Srp68 C T 11: 116,248,747 V459M probably damaging Het
Stxbp4 C T 11: 90,548,975 V346I probably benign Het
Syne2 A G 12: 75,952,826 D2331G probably damaging Het
Ttn A T 2: 76,734,192 Y28534N probably damaging Het
Usp44 A T 10: 93,846,845 I386F possibly damaging Het
Vmn2r15 T C 5: 109,288,451 probably null Het
Vmn2r72 T A 7: 85,737,853 L834F probably damaging Het
Vps13b T A 15: 35,923,202 I3741K probably damaging Het
Zfp607b T A 7: 27,693,636 probably benign Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63306514 missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63307205 missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63303038 missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63303077 missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63308074 missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63304006 nonsense probably null
R0148:Zdbf2 UTSW 1 63304006 nonsense probably null
R0433:Zdbf2 UTSW 1 63306143 missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63305290 missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63304950 missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63305723 missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63303430 missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63303002 missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63309073 missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63303053 missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63303040 missense possibly damaging 0.66
R1562:Zdbf2 UTSW 1 63303588 missense possibly damaging 0.83
R1624:Zdbf2 UTSW 1 63303859 missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63304334 missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63308972 missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63304249 nonsense probably null
R1700:Zdbf2 UTSW 1 63302741 missense unknown
R1720:Zdbf2 UTSW 1 63303277 missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63305542 frame shift probably null
R1854:Zdbf2 UTSW 1 63305542 frame shift probably null
R1973:Zdbf2 UTSW 1 63309701 missense unknown
R2336:Zdbf2 UTSW 1 63303464 missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63305615 missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63303065 missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63304205 missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63307477 missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63308420 missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63308671 missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63308324 missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63309781 missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63302861 missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63306591 missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63308792 missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63303238 missense possibly damaging 0.66
R4928:Zdbf2 UTSW 1 63308814 missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63302914 missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63303650 missense possibly damaging 0.82
R5149:Zdbf2 UTSW 1 63304903 missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63304411 missense possibly damaging 0.66
R5341:Zdbf2 UTSW 1 63307933 missense probably benign 0.27
R5511:Zdbf2 UTSW 1 63305677 missense probably benign 0.03
R5809:Zdbf2 UTSW 1 63305876 missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63306526 missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63280818 start gained probably benign
R6245:Zdbf2 UTSW 1 63304433 missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63307822 missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63303321 missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63307478 missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63305520 missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63303914 missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63304508 missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63304520 missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63308528 missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63308872 missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63290766 missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63306766 missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63307404 missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63307559 missense probably benign
R7177:Zdbf2 UTSW 1 63294961 missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63306505 missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63303404 missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63304039 missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63307510 missense probably benign
R7695:Zdbf2 UTSW 1 63307370 missense possibly damaging 0.83
R7712:Zdbf2 UTSW 1 63305371 missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63304105 missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63308007 nonsense probably null
R7759:Zdbf2 UTSW 1 63308376 missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63303424 missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63306827 missense possibly damaging 0.46
R7970:Zdbf2 UTSW 1 63304171 missense possibly damaging 0.92
R8076:Zdbf2 UTSW 1 63306101 missense possibly damaging 0.92
R8152:Zdbf2 UTSW 1 63306413 missense possibly damaging 0.92
R8195:Zdbf2 UTSW 1 63304066 missense possibly damaging 0.83
R8272:Zdbf2 UTSW 1 63305983 missense probably benign
R8306:Zdbf2 UTSW 1 63304075 missense possibly damaging 0.66
R8309:Zdbf2 UTSW 1 63306591 missense possibly damaging 0.82
R8323:Zdbf2 UTSW 1 63302914 missense possibly damaging 0.46
R8400:Zdbf2 UTSW 1 63304976 missense possibly damaging 0.92
R8443:Zdbf2 UTSW 1 63306007 missense possibly damaging 0.83
R8460:Zdbf2 UTSW 1 63309570 small deletion probably benign
R8528:Zdbf2 UTSW 1 63303386 missense possibly damaging 0.82
R8812:Zdbf2 UTSW 1 63308113 missense probably benign 0.00
R8962:Zdbf2 UTSW 1 63308003 missense probably benign 0.00
R9061:Zdbf2 UTSW 1 63307137 missense
R9072:Zdbf2 UTSW 1 63305764 missense possibly damaging 0.83
R9232:Zdbf2 UTSW 1 63308009 missense possibly damaging 0.66
R9257:Zdbf2 UTSW 1 63306241 missense probably damaging 1.00
R9411:Zdbf2 UTSW 1 63304129 missense probably damaging 0.97
R9470:Zdbf2 UTSW 1 63305625 missense possibly damaging 0.82
R9606:Zdbf2 UTSW 1 63303377 missense possibly damaging 0.92
R9621:Zdbf2 UTSW 1 63303476 missense possibly damaging 0.66
RF021:Zdbf2 UTSW 1 63302652 missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63305351 missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63308007 nonsense probably null
X0057:Zdbf2 UTSW 1 63305390 missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63305537 missense probably benign 0.04
Z1176:Zdbf2 UTSW 1 63304245 missense possibly damaging 0.83
Z1177:Zdbf2 UTSW 1 63304086 frame shift probably null
Z1177:Zdbf2 UTSW 1 63309203 missense unknown
Predicted Primers PCR Primer
(F):5'- GATGGTTGCTGCAAATAAATTATGCC -3'
(R):5'- GCACCAGCTGGGAGAACC -3'

Sequencing Primer
(F):5'- GCTGCAAATAAATTATGCCTCATC -3'
(R):5'- GAGGGGTGCACAGGGCC -3'
Posted On 2016-06-21