Incidental Mutation 'R5095:F2'
ID 395803
Institutional Source Beutler Lab
Gene Symbol F2
Ensembl Gene ENSMUSG00000027249
Gene Name coagulation factor II
Synonyms Cf-2, FII, prothrombin, Cf2, thrombin
MMRRC Submission 042684-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5095 (G1)
Quality Score 217
Status Validated
Chromosome 2
Chromosomal Location 91455665-91466759 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) CAGAAAG to CAG at 91465302 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028681] [ENSMUST00000111335]
AlphaFold P19221
Predicted Effect probably benign
Transcript: ENSMUST00000028681
SMART Domains Protein: ENSMUSP00000028681
Gene: ENSMUSG00000027249

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GLA 25 89 1.91e-30 SMART
KR 107 189 7.47e-37 SMART
KR 213 295 5.09e-30 SMART
Tryp_SPc 360 610 9.99e-84 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111335
SMART Domains Protein: ENSMUSP00000106967
Gene: ENSMUSG00000027249

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GLA 25 89 1.91e-30 SMART
KR 107 189 8.01e-37 SMART
KR 212 294 5.09e-30 SMART
Tryp_SPc 359 609 9.99e-84 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153182
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent glycoprotein coagulation factor that plays an important role in the process of blood coagulation and hemostasis. The encoded protein is an inactive zymogen that undergoes enzymatic cleavage by the coagulation factor Xa to form an active serine protease that converts soluble fibrinogen to insoluble fibrin clot. Most of the mice lacking the encoded protein die at an embryonic stage due to defects in yolk sac vasculature, while the rare nenonates succumb to hemorrhage on the first postnatal day. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in yolk sac vasculature, internal bleeding, tissue necrosis, and die in mid- to late-gestation, or rarely, a few days after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021A07Rik G C 10: 21,301,492 (GRCm39) noncoding transcript Het
Adgrv1 C T 13: 81,243,606 (GRCm39) V6265I probably benign Het
Agbl1 G A 7: 76,369,881 (GRCm39) G660D probably damaging Het
Arap2 A G 5: 62,811,392 (GRCm39) Y1140H probably damaging Het
Atp6v1c1 T C 15: 38,679,657 (GRCm39) probably null Het
C1rb A T 6: 124,557,272 (GRCm39) R470W possibly damaging Het
Caskin2 T C 11: 115,691,564 (GRCm39) T1074A probably benign Het
Cdh19 T A 1: 110,882,391 (GRCm39) T34S probably benign Het
Csnk1a1 T A 18: 61,708,547 (GRCm39) Y175N probably damaging Het
Flt4 T A 11: 49,517,986 (GRCm39) V342D possibly damaging Het
Frmd5 A T 2: 121,379,402 (GRCm39) C394S possibly damaging Het
Gm5414 T G 15: 101,532,473 (GRCm39) N550T probably benign Het
Hcn3 C A 3: 89,057,230 (GRCm39) R456L probably damaging Het
Htt T C 5: 34,981,739 (GRCm39) V893A possibly damaging Het
Ift46 A G 9: 44,698,146 (GRCm39) D203G probably damaging Het
Itga10 G T 3: 96,555,480 (GRCm39) V145L probably benign Het
Kcnh6 A G 11: 105,908,080 (GRCm39) D232G possibly damaging Het
Mbtd1 T C 11: 93,820,497 (GRCm39) S431P probably damaging Het
Mmp27 T A 9: 7,572,159 (GRCm39) W120R probably damaging Het
Mmp27 A T 9: 7,579,001 (GRCm39) D418V probably damaging Het
Myo5a A G 9: 75,059,302 (GRCm39) D510G probably damaging Het
Myo5a A T 9: 75,091,671 (GRCm39) K1179* probably null Het
Neto1 T C 18: 86,416,406 (GRCm39) S38P probably benign Het
Nos3 A G 5: 24,573,916 (GRCm39) probably benign Het
Nuggc C T 14: 65,872,539 (GRCm39) R512* probably null Het
Oas1e T A 5: 120,932,329 (GRCm39) K105* probably null Het
Omd T A 13: 49,743,174 (GRCm39) S75T possibly damaging Het
Or10a3m T C 7: 108,313,019 (GRCm39) F141S probably damaging Het
Or2n1c A C 17: 38,519,208 (GRCm39) E24A possibly damaging Het
Pbrm1 A G 14: 30,754,487 (GRCm39) N190S probably benign Het
Picalm T C 7: 89,819,841 (GRCm39) F85L probably damaging Het
Polg A G 7: 79,110,048 (GRCm39) V360A possibly damaging Het
Prex1 T C 2: 166,423,841 (GRCm39) D1017G probably damaging Het
Prss56 G C 1: 87,115,833 (GRCm39) R569P probably damaging Het
Rab6b G A 9: 103,017,583 (GRCm39) G25R probably damaging Het
Rdh10 A G 1: 16,201,609 (GRCm39) T332A probably benign Het
Rheb A T 5: 25,012,639 (GRCm39) M115K probably benign Het
Rnf149 A T 1: 39,594,737 (GRCm39) D321E probably benign Het
Rps28 C T 17: 34,042,177 (GRCm39) probably null Het
Slc6a20b A G 9: 123,424,119 (GRCm39) V616A probably benign Het
Smarcc2 A G 10: 128,305,169 (GRCm39) K300R probably damaging Het
Sparcl1 C T 5: 104,233,629 (GRCm39) M573I probably damaging Het
Spata31h1 G T 10: 82,119,501 (GRCm39) A4503E probably damaging Het
Srp68 C T 11: 116,139,573 (GRCm39) V459M probably damaging Het
Stxbp4 C T 11: 90,439,801 (GRCm39) V346I probably benign Het
Syne2 A G 12: 75,999,600 (GRCm39) D2331G probably damaging Het
Ttn A T 2: 76,564,536 (GRCm39) Y28534N probably damaging Het
Usp44 A T 10: 93,682,707 (GRCm39) I386F possibly damaging Het
Vmn2r15 T C 5: 109,436,317 (GRCm39) probably null Het
Vmn2r72 T A 7: 85,387,061 (GRCm39) L834F probably damaging Het
Vps13b T A 15: 35,923,348 (GRCm39) I3741K probably damaging Het
Zdbf2 A G 1: 63,348,232 (GRCm39) T2204A possibly damaging Het
Zfp607b T A 7: 27,393,061 (GRCm39) probably benign Het
Other mutations in F2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02334:F2 APN 2 91,463,439 (GRCm39) missense probably benign 0.16
IGL02390:F2 APN 2 91,463,332 (GRCm39) missense possibly damaging 0.81
IGL02859:F2 APN 2 91,456,087 (GRCm39) missense probably damaging 1.00
IGL02970:F2 APN 2 91,455,896 (GRCm39) missense possibly damaging 0.95
IGL03278:F2 APN 2 91,465,527 (GRCm39) missense probably benign 0.01
Sarode UTSW 2 91,465,539 (GRCm39) missense probably benign 0.35
R0007:F2 UTSW 2 91,460,952 (GRCm39) missense probably benign 0.00
R0015:F2 UTSW 2 91,460,952 (GRCm39) missense probably benign 0.00
R0137:F2 UTSW 2 91,456,075 (GRCm39) missense probably damaging 1.00
R0211:F2 UTSW 2 91,460,503 (GRCm39) missense probably damaging 1.00
R0304:F2 UTSW 2 91,463,578 (GRCm39) missense probably damaging 0.99
R0601:F2 UTSW 2 91,463,656 (GRCm39) splice site probably null
R0830:F2 UTSW 2 91,460,545 (GRCm39) missense probably benign 0.34
R1693:F2 UTSW 2 91,459,524 (GRCm39) missense probably damaging 1.00
R1720:F2 UTSW 2 91,459,175 (GRCm39) nonsense probably null
R1763:F2 UTSW 2 91,465,251 (GRCm39) missense probably damaging 1.00
R1865:F2 UTSW 2 91,465,539 (GRCm39) missense probably benign 0.35
R1955:F2 UTSW 2 91,463,440 (GRCm39) missense probably benign 0.01
R2055:F2 UTSW 2 91,458,787 (GRCm39) missense probably benign 0.00
R2168:F2 UTSW 2 91,458,693 (GRCm39) missense probably damaging 0.98
R2230:F2 UTSW 2 91,456,102 (GRCm39) missense probably benign 0.01
R3916:F2 UTSW 2 91,455,833 (GRCm39) missense probably damaging 1.00
R4004:F2 UTSW 2 91,458,741 (GRCm39) missense possibly damaging 0.88
R4134:F2 UTSW 2 91,459,553 (GRCm39) missense possibly damaging 0.93
R4298:F2 UTSW 2 91,459,665 (GRCm39) critical splice acceptor site probably null
R4626:F2 UTSW 2 91,461,015 (GRCm39) missense probably benign 0.07
R4902:F2 UTSW 2 91,465,316 (GRCm39) intron probably benign
R5093:F2 UTSW 2 91,465,302 (GRCm39) splice site probably benign
R5140:F2 UTSW 2 91,465,302 (GRCm39) splice site probably benign
R5229:F2 UTSW 2 91,460,586 (GRCm39) nonsense probably null
R5271:F2 UTSW 2 91,465,466 (GRCm39) intron probably benign
R5335:F2 UTSW 2 91,465,277 (GRCm39) missense possibly damaging 0.68
R7650:F2 UTSW 2 91,458,741 (GRCm39) missense possibly damaging 0.88
R7762:F2 UTSW 2 91,459,041 (GRCm39) missense possibly damaging 0.61
R8178:F2 UTSW 2 91,460,618 (GRCm39) splice site probably null
R8976:F2 UTSW 2 91,466,738 (GRCm39) missense probably benign
R9458:F2 UTSW 2 91,461,113 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAACAGTCTAAGTGCCAGCC -3'
(R):5'- CGCTCCACTAGAGAATGTCCTC -3'

Sequencing Primer
(F):5'- GGCCACATGCAAAGACATCCTTG -3'
(R):5'- AGAGAATGTCCTCTCCCTCAG -3'
Posted On 2016-06-21