Mutagenetix > Incidental Mutation

Incidental Mutation 'R5095:Itga10'

395807

Institutional Source

Beutler Lab

Gene Symbol

Itga10

Ensembl Gene

ENSMUSG00000090210

Gene Name

integrin, alpha 10

Synonyms

MMRRC Submission

042684-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.195) question?

Stock #

R5095 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96645584-96664519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 96648164 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 145 (V145L)

Ref Sequence

ENSEMBL: ENSMUSP00000112393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000048766] [ENSMUST00000118557] [ENSMUST00000119365] [ENSMUST00000137564] [ENSMUST00000156015] [ENSMUST00000165842]

AlphaFold

E9Q6R1

Predicted Effect

probably benign
Transcript: ENSMUST00000029744
AA Change: V145L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210
AA Change: V145L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1123	1145	N/A	INTRINSIC
low complexity region	1153	1166	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000048766

SMART Domains

Protein: ENSMUSP00000037962
Gene: ENSMUSG00000028102

Domain	Start	End	E-Value	Type
Pfam:PEX11	1	251	1.9e-76	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000118557

SMART Domains

Protein: ENSMUSP00000113365
Gene: ENSMUSG00000028102

Domain	Start	End	E-Value	Type
Pfam:PEX11	1	251	8.3e-77	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000119365
AA Change: V145L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210
AA Change: V145L

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1122	1144	N/A	INTRINSIC
low complexity region	1152	1165	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000137564
AA Change: V330L

SMART Domains

Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447
AA Change: V330L

Domain	Start	End	E-Value	Type
Pfam:PEX11	1	172	4.5e-57	PFAM
low complexity region	186	204	N/A	INTRINSIC
Int_alpha	222	278	9.03e-3	SMART
Blast:VWA	292	345	3e-7	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144962

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147821

Predicted Effect

probably benign
Transcript: ENSMUST00000156015

Predicted Effect

probably benign
Transcript: ENSMUST00000165842

SMART Domains

Protein: ENSMUSP00000126631
Gene: ENSMUSG00000028102

Domain	Start	End	E-Value	Type
Pfam:PEX11	3	237	8.9e-69	PFAM

Meta Mutation Damage Score

0.0649

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021A07Rik	G	C	10: 21,425,593		noncoding transcript	Het
4932415D10Rik	G	T	10: 82,283,667	A4503E	probably damaging	Het
Adgrv1	C	T	13: 81,095,487	V6265I	probably benign	Het
Agbl1	G	A	7: 76,720,133	G660D	probably damaging	Het
Arap2	A	G	5: 62,654,049	Y1140H	probably damaging	Het
Atp6v1c1	T	C	15: 38,679,413		probably null	Het
C1rb	A	T	6: 124,580,313	R470W	possibly damaging	Het
Caskin2	T	C	11: 115,800,738	T1074A	probably benign	Het
Cdh19	T	A	1: 110,954,661	T34S	probably benign	Het
Csnk1a1	T	A	18: 61,575,476	Y175N	probably damaging	Het
F2	CAGAAAG	CAG	2: 91,634,957		probably benign	Het
Flt4	T	A	11: 49,627,159	V342D	possibly damaging	Het
Frmd5	A	T	2: 121,548,921	C394S	possibly damaging	Het
Gm5414	T	G	15: 101,624,038	N550T	probably benign	Het
Hcn3	C	A	3: 89,149,923	R456L	probably damaging	Het
Htt	T	C	5: 34,824,395	V893A	possibly damaging	Het
Ift46	A	G	9: 44,786,849	D203G	probably damaging	Het
Kcnh6	A	G	11: 106,017,254	D232G	possibly damaging	Het
Mbtd1	T	C	11: 93,929,671	S431P	probably damaging	Het
Mmp27	T	A	9: 7,572,158	W120R	probably damaging	Het
Mmp27	A	T	9: 7,579,000	D418V	probably damaging	Het
Myo5a	A	G	9: 75,152,020	D510G	probably damaging	Het
Myo5a	A	T	9: 75,184,389	K1179*	probably null	Het
Neto1	T	C	18: 86,398,281	S38P	probably benign	Het
Nos3	A	G	5: 24,368,918		probably benign	Het
Nuggc	C	T	14: 65,635,090	R512*	probably null	Het
Oas1e	T	A	5: 120,794,264	K105*	probably null	Het
Olfr135	A	C	17: 38,208,317	E24A	possibly damaging	Het
Olfr512	T	C	7: 108,713,812	F141S	probably damaging	Het
Omd	T	A	13: 49,589,698	S75T	possibly damaging	Het
Pbrm1	A	G	14: 31,032,530	N190S	probably benign	Het
Picalm	T	C	7: 90,170,633	F85L	probably damaging	Het
Polg	A	G	7: 79,460,300	V360A	possibly damaging	Het
Prex1	T	C	2: 166,581,921	D1017G	probably damaging	Het
Prss56	G	C	1: 87,188,111	R569P	probably damaging	Het
Rab6b	G	A	9: 103,140,384	G25R	probably damaging	Het
Rdh10	A	G	1: 16,131,385	T332A	probably benign	Het
Rheb	A	T	5: 24,807,641	M115K	probably benign	Het
Rnf149	A	T	1: 39,555,656	D321E	probably benign	Het
Rps28	C	T	17: 33,823,203		probably null	Het
Slc6a20b	A	G	9: 123,595,054	V616A	probably benign	Het
Smarcc2	A	G	10: 128,469,300	K300R	probably damaging	Het
Sparcl1	C	T	5: 104,085,763	M573I	probably damaging	Het
Srp68	C	T	11: 116,248,747	V459M	probably damaging	Het
Stxbp4	C	T	11: 90,548,975	V346I	probably benign	Het
Syne2	A	G	12: 75,952,826	D2331G	probably damaging	Het
Ttn	A	T	2: 76,734,192	Y28534N	probably damaging	Het
Usp44	A	T	10: 93,846,845	I386F	possibly damaging	Het
Vmn2r15	T	C	5: 109,288,451		probably null	Het
Vmn2r72	T	A	7: 85,737,853	L834F	probably damaging	Het
Vps13b	T	A	15: 35,923,202	I3741K	probably damaging	Het
Zdbf2	A	G	1: 63,309,073	T2204A	possibly damaging	Het
Zfp607b	T	A	7: 27,693,636		probably benign	Het

Other mutations in Itga10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Itga10	APN	3	96647641	missense	probably damaging	0.96
IGL01694:Itga10	APN	3	96652517	missense	probably damaging	0.99
IGL01754:Itga10	APN	3	96656775	unclassified	probably benign
IGL02527:Itga10	APN	3	96655624	unclassified	probably benign
IGL02956:Itga10	APN	3	96655113	missense	possibly damaging	0.46
IGL03371:Itga10	APN	3	96654788	missense	possibly damaging	0.84
IGL03055:Itga10	UTSW	3	96650520	missense	probably damaging	0.99
PIT4515001:Itga10	UTSW	3	96662632	missense	probably damaging	0.99
R0153:Itga10	UTSW	3	96653700	missense	probably benign	0.00
R0308:Itga10	UTSW	3	96651464	missense	probably damaging	1.00
R0331:Itga10	UTSW	3	96652483	missense	probably damaging	1.00
R0413:Itga10	UTSW	3	96649059	missense	probably damaging	1.00
R0437:Itga10	UTSW	3	96649137	missense	probably damaging	1.00
R0511:Itga10	UTSW	3	96658174	missense	probably damaging	1.00
R0630:Itga10	UTSW	3	96656299	unclassified	probably benign
R0844:Itga10	UTSW	3	96651738	splice site	probably benign
R0849:Itga10	UTSW	3	96652530	missense	possibly damaging	0.67
R0894:Itga10	UTSW	3	96653660	missense	possibly damaging	0.69
R0919:Itga10	UTSW	3	96651738	splice site	probably benign
R1027:Itga10	UTSW	3	96651738	splice site	probably benign
R1341:Itga10	UTSW	3	96652495	missense	probably damaging	1.00
R1350:Itga10	UTSW	3	96657477	missense	probably benign	0.01
R1370:Itga10	UTSW	3	96651738	splice site	probably benign
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1589:Itga10	UTSW	3	96651738	splice site	probably benign
R1590:Itga10	UTSW	3	96651738	splice site	probably benign
R1601:Itga10	UTSW	3	96653658	missense	possibly damaging	0.82
R1659:Itga10	UTSW	3	96662977	missense	probably damaging	0.96
R1665:Itga10	UTSW	3	96651738	splice site	probably benign
R1667:Itga10	UTSW	3	96651738	splice site	probably benign
R1686:Itga10	UTSW	3	96651825	missense	probably damaging	0.97
R1972:Itga10	UTSW	3	96651738	splice site	probably benign
R1976:Itga10	UTSW	3	96651738	splice site	probably benign
R2020:Itga10	UTSW	3	96652490	missense	probably damaging	1.00
R2040:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96657690	missense	probably benign
R2045:Itga10	UTSW	3	96651738	splice site	probably benign
R2060:Itga10	UTSW	3	96654998	nonsense	probably null
R2146:Itga10	UTSW	3	96651492	missense	possibly damaging	0.59
R2146:Itga10	UTSW	3	96653723	missense	probably damaging	1.00
R2170:Itga10	UTSW	3	96650457	missense	probably damaging	1.00
R2893:Itga10	UTSW	3	96655100	missense	probably benign	0.11
R2926:Itga10	UTSW	3	96652849	missense	probably damaging	1.00
R3622:Itga10	UTSW	3	96651738	splice site	probably benign
R3623:Itga10	UTSW	3	96651738	splice site	probably benign
R4416:Itga10	UTSW	3	96658246	missense	possibly damaging	0.58
R4633:Itga10	UTSW	3	96647704	missense	possibly damaging	0.92
R5074:Itga10	UTSW	3	96652211	nonsense	probably null
R5495:Itga10	UTSW	3	96647371	missense	possibly damaging	0.92
R5813:Itga10	UTSW	3	96652585	missense	probably benign	0.38
R6114:Itga10	UTSW	3	96649035	missense	probably damaging	1.00
R6172:Itga10	UTSW	3	96647437	missense	probably benign	0.18
R6275:Itga10	UTSW	3	96658185	missense	probably benign	0.36
R6298:Itga10	UTSW	3	96656762	missense	probably benign	0.00
R6433:Itga10	UTSW	3	96658041	critical splice donor site	probably null
R6841:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R6909:Itga10	UTSW	3	96662599	missense	probably benign	0.00
R6927:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R7124:Itga10	UTSW	3	96651765	missense	probably damaging	0.96
R7310:Itga10	UTSW	3	96648159	missense	probably damaging	1.00
R7387:Itga10	UTSW	3	96652778	missense	probably benign	0.11
R7464:Itga10	UTSW	3	96648155	missense	probably damaging	1.00
R7624:Itga10	UTSW	3	96652953	missense	probably benign
R7638:Itga10	UTSW	3	96657391	splice site	probably null
R7639:Itga10	UTSW	3	96649582	missense	probably benign	0.36
R7893:Itga10	UTSW	3	96649612	missense	probably damaging	1.00
R8297:Itga10	UTSW	3	96654800	missense	probably damaging	1.00
R8753:Itga10	UTSW	3	96651155	missense	probably damaging	1.00
R9526:Itga10	UTSW	3	96656957	missense	probably damaging	1.00
X0064:Itga10	UTSW	3	96652936	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CACCGTGGTAAGGGAAATTAGTC -3'
(R):5'- AGCCTCTTCTGCAAGCACAC -3'

Sequencing Primer
(F):5'- TTCAAAACCCTAGAGAGCAAGG -3'
(R):5'- CACTTGGGAATGATGAGGATAGCC -3'

Posted On

2016-06-21