Mutagenetix > Incidental Mutation

Incidental Mutation 'R5095:Vmn2r15'

395813

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r15

Ensembl Gene

ENSMUSG00000091375

Gene Name

vomeronasal 2, receptor 15

Synonyms

EG211223

MMRRC Submission

042684-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R5095 (G1)

Quality Score

181

Status

Validated

Chromosome

Chromosomal Location

109286269-109297556 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to C at 109288451 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000128333 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167133] [ENSMUST00000167133] [ENSMUST00000167133]

AlphaFold

L7N2A0

Predicted Effect

probably null
Transcript: ENSMUST00000167133

SMART Domains

Protein: ENSMUSP00000128333
Gene: ENSMUSG00000091375

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	75	472	1e-29	PFAM
Pfam:NCD3G	514	568	5.8e-18	PFAM
Pfam:7tm_3	601	836	9.1e-55	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000167133

SMART Domains

Protein: ENSMUSP00000128333
Gene: ENSMUSG00000091375

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	75	472	1e-29	PFAM
Pfam:NCD3G	514	568	5.8e-18	PFAM
Pfam:7tm_3	601	836	9.1e-55	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000167133

SMART Domains

Protein: ENSMUSP00000128333
Gene: ENSMUSG00000091375

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	75	472	1e-29	PFAM
Pfam:NCD3G	514	568	5.8e-18	PFAM
Pfam:7tm_3	601	836	9.1e-55	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

98% (59/60)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021A07Rik	G	C	10: 21,425,593		noncoding transcript	Het
4932415D10Rik	G	T	10: 82,283,667	A4503E	probably damaging	Het
Adgrv1	C	T	13: 81,095,487	V6265I	probably benign	Het
Agbl1	G	A	7: 76,720,133	G660D	probably damaging	Het
Arap2	A	G	5: 62,654,049	Y1140H	probably damaging	Het
Atp6v1c1	T	C	15: 38,679,413		probably null	Het
C1rb	A	T	6: 124,580,313	R470W	possibly damaging	Het
Caskin2	T	C	11: 115,800,738	T1074A	probably benign	Het
Cdh19	T	A	1: 110,954,661	T34S	probably benign	Het
Csnk1a1	T	A	18: 61,575,476	Y175N	probably damaging	Het
F2	CAGAAAG	CAG	2: 91,634,957		probably benign	Het
Flt4	T	A	11: 49,627,159	V342D	possibly damaging	Het
Frmd5	A	T	2: 121,548,921	C394S	possibly damaging	Het
Gm5414	T	G	15: 101,624,038	N550T	probably benign	Het
Hcn3	C	A	3: 89,149,923	R456L	probably damaging	Het
Htt	T	C	5: 34,824,395	V893A	possibly damaging	Het
Ift46	A	G	9: 44,786,849	D203G	probably damaging	Het
Itga10	G	T	3: 96,648,164	V145L	probably benign	Het
Kcnh6	A	G	11: 106,017,254	D232G	possibly damaging	Het
Mbtd1	T	C	11: 93,929,671	S431P	probably damaging	Het
Mmp27	T	A	9: 7,572,158	W120R	probably damaging	Het
Mmp27	A	T	9: 7,579,000	D418V	probably damaging	Het
Myo5a	A	G	9: 75,152,020	D510G	probably damaging	Het
Myo5a	A	T	9: 75,184,389	K1179*	probably null	Het
Neto1	T	C	18: 86,398,281	S38P	probably benign	Het
Nos3	A	G	5: 24,368,918		probably benign	Het
Nuggc	C	T	14: 65,635,090	R512*	probably null	Het
Oas1e	T	A	5: 120,794,264	K105*	probably null	Het
Olfr135	A	C	17: 38,208,317	E24A	possibly damaging	Het
Olfr512	T	C	7: 108,713,812	F141S	probably damaging	Het
Omd	T	A	13: 49,589,698	S75T	possibly damaging	Het
Pbrm1	A	G	14: 31,032,530	N190S	probably benign	Het
Picalm	T	C	7: 90,170,633	F85L	probably damaging	Het
Polg	A	G	7: 79,460,300	V360A	possibly damaging	Het
Prex1	T	C	2: 166,581,921	D1017G	probably damaging	Het
Prss56	G	C	1: 87,188,111	R569P	probably damaging	Het
Rab6b	G	A	9: 103,140,384	G25R	probably damaging	Het
Rdh10	A	G	1: 16,131,385	T332A	probably benign	Het
Rheb	A	T	5: 24,807,641	M115K	probably benign	Het
Rnf149	A	T	1: 39,555,656	D321E	probably benign	Het
Rps28	C	T	17: 33,823,203		probably null	Het
Slc6a20b	A	G	9: 123,595,054	V616A	probably benign	Het
Smarcc2	A	G	10: 128,469,300	K300R	probably damaging	Het
Sparcl1	C	T	5: 104,085,763	M573I	probably damaging	Het
Srp68	C	T	11: 116,248,747	V459M	probably damaging	Het
Stxbp4	C	T	11: 90,548,975	V346I	probably benign	Het
Syne2	A	G	12: 75,952,826	D2331G	probably damaging	Het
Ttn	A	T	2: 76,734,192	Y28534N	probably damaging	Het
Usp44	A	T	10: 93,846,845	I386F	possibly damaging	Het
Vmn2r72	T	A	7: 85,737,853	L834F	probably damaging	Het
Vps13b	T	A	15: 35,923,202	I3741K	probably damaging	Het
Zdbf2	A	G	1: 63,309,073	T2204A	possibly damaging	Het
Zfp607b	T	A	7: 27,693,636		probably benign	Het

Other mutations in Vmn2r15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01335:Vmn2r15	APN	5	109286736	missense	possibly damaging	0.70
IGL01367:Vmn2r15	APN	5	109293209	missense	probably damaging	0.99
IGL01844:Vmn2r15	APN	5	109286269	makesense	probably null
IGL02190:Vmn2r15	APN	5	109293374	missense	probably damaging	1.00
IGL02754:Vmn2r15	APN	5	109293268	nonsense	probably null
IGL02797:Vmn2r15	APN	5	109297384	missense	probably benign	0.18
IGL03301:Vmn2r15	APN	5	109297355	critical splice donor site	probably null
IGL03407:Vmn2r15	APN	5	109286319	nonsense	probably null
BB001:Vmn2r15	UTSW	5	109286388	missense	probably damaging	1.00
BB011:Vmn2r15	UTSW	5	109286388	missense	probably damaging	1.00
PIT4445001:Vmn2r15	UTSW	5	109287142	missense	probably damaging	0.99
PIT4520001:Vmn2r15	UTSW	5	109287005	missense	probably damaging	1.00
R0038:Vmn2r15	UTSW	5	109293144	missense	possibly damaging	0.46
R0111:Vmn2r15	UTSW	5	109287156	missense	possibly damaging	0.56
R0379:Vmn2r15	UTSW	5	109286478	missense	probably damaging	1.00
R0427:Vmn2r15	UTSW	5	109287087	missense	probably damaging	1.00
R0639:Vmn2r15	UTSW	5	109293015	missense	probably benign	0.22
R0964:Vmn2r15	UTSW	5	109297535	missense	probably benign	0.34
R1147:Vmn2r15	UTSW	5	109293206	missense	probably damaging	1.00
R1147:Vmn2r15	UTSW	5	109293206	missense	probably damaging	1.00
R1232:Vmn2r15	UTSW	5	109293302	missense	probably benign	0.39
R1241:Vmn2r15	UTSW	5	109292904	missense	probably damaging	1.00
R1244:Vmn2r15	UTSW	5	109293226	nonsense	probably null
R1394:Vmn2r15	UTSW	5	109294148	missense	probably benign	0.44
R1395:Vmn2r15	UTSW	5	109294148	missense	probably benign	0.44
R1423:Vmn2r15	UTSW	5	109293227	missense	probably damaging	1.00
R1439:Vmn2r15	UTSW	5	109294087	missense	probably damaging	1.00
R1513:Vmn2r15	UTSW	5	109293329	missense	probably damaging	1.00
R1777:Vmn2r15	UTSW	5	109294270	missense	possibly damaging	0.79
R1844:Vmn2r15	UTSW	5	109286994	nonsense	probably null
R2072:Vmn2r15	UTSW	5	109286753	missense	possibly damaging	0.65
R2074:Vmn2r15	UTSW	5	109286753	missense	possibly damaging	0.65
R2122:Vmn2r15	UTSW	5	109286456	missense	probably damaging	1.00
R2208:Vmn2r15	UTSW	5	109297443	missense	possibly damaging	0.64
R2268:Vmn2r15	UTSW	5	109293207	missense	probably benign	0.31
R2831:Vmn2r15	UTSW	5	109286592	missense	probably damaging	1.00
R3848:Vmn2r15	UTSW	5	109297446	missense	probably benign	0.00
R4058:Vmn2r15	UTSW	5	109293446	missense	probably damaging	0.99
R4615:Vmn2r15	UTSW	5	109293482	missense	possibly damaging	0.91
R4663:Vmn2r15	UTSW	5	109294074	missense	probably benign
R4681:Vmn2r15	UTSW	5	109286622	missense	probably damaging	0.97
R4751:Vmn2r15	UTSW	5	109286754	missense	probably benign	0.01
R5300:Vmn2r15	UTSW	5	109294108	missense	probably damaging	0.99
R5309:Vmn2r15	UTSW	5	109293090	missense	probably damaging	0.99
R5335:Vmn2r15	UTSW	5	109286807	missense	probably damaging	0.99
R5421:Vmn2r15	UTSW	5	109286535	missense	probably damaging	1.00
R5805:Vmn2r15	UTSW	5	109286940	missense	possibly damaging	0.88
R6280:Vmn2r15	UTSW	5	109293425	missense	possibly damaging	0.65
R6324:Vmn2r15	UTSW	5	109286271	makesense	probably null
R6383:Vmn2r15	UTSW	5	109293226	nonsense	probably null
R6772:Vmn2r15	UTSW	5	109286372	missense	probably damaging	0.99
R6991:Vmn2r15	UTSW	5	109293314	missense	probably damaging	1.00
R7194:Vmn2r15	UTSW	5	109292783	missense	probably damaging	1.00
R7365:Vmn2r15	UTSW	5	109293239	missense	probably benign	0.19
R7365:Vmn2r15	UTSW	5	109297522	missense	probably benign	0.15
R7423:Vmn2r15	UTSW	5	109297528	missense	probably benign	0.00
R7552:Vmn2r15	UTSW	5	109292908	nonsense	probably null
R7619:Vmn2r15	UTSW	5	109288324	critical splice donor site	probably null
R7892:Vmn2r15	UTSW	5	109286351	missense	probably damaging	1.00
R7924:Vmn2r15	UTSW	5	109286388	missense	probably damaging	1.00
R8058:Vmn2r15	UTSW	5	109293090	missense	probably damaging	0.99
R8099:Vmn2r15	UTSW	5	109293319	missense	possibly damaging	0.58
R8189:Vmn2r15	UTSW	5	109286847	missense	probably benign	0.02
R8275:Vmn2r15	UTSW	5	109286284	missense	probably benign	0.08
R8277:Vmn2r15	UTSW	5	109293104	missense	probably benign	0.00
R8277:Vmn2r15	UTSW	5	109293444	missense	probably damaging	1.00
R8465:Vmn2r15	UTSW	5	109297436	missense	probably damaging	1.00
R8679:Vmn2r15	UTSW	5	109286913	missense	probably benign	0.31
R8682:Vmn2r15	UTSW	5	109294072	missense	probably damaging	0.98
R8809:Vmn2r15	UTSW	5	109287008	missense	probably benign	0.22
R9016:Vmn2r15	UTSW	5	109294243	missense	probably benign	0.01
R9372:Vmn2r15	UTSW	5	109294087	missense	possibly damaging	0.60
R9596:Vmn2r15	UTSW	5	109292925	missense	probably benign	0.01
R9619:Vmn2r15	UTSW	5	109292756	missense	possibly damaging	0.58
R9685:Vmn2r15	UTSW	5	109292732	missense	probably benign	0.05
R9716:Vmn2r15	UTSW	5	109297358	missense	possibly damaging	0.88
R9772:Vmn2r15	UTSW	5	109287057	missense	probably damaging	1.00
X0065:Vmn2r15	UTSW	5	109293308	missense	probably damaging	1.00
Z1187:Vmn2r15	UTSW	5	109286663	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGGACTTCAGTTTCCATCTAGGC -3'
(R):5'- ATGACATTCAGTGCATTGCATG -3'

Sequencing Primer
(F):5'- CTAGTTTGGAAAAAGAAGGCTTCTG -3'
(R):5'- CAGTGCATTGCATGATAATACAAAC -3'

Posted On

2016-06-21