Incidental Mutation 'R5095:Zfp607b'
ID395817
Institutional Source Beutler Lab
Gene Symbol Zfp607b
Ensembl Gene ENSMUSG00000057093
Gene Namezinc finger protein 607B
SynonymsC030039L03Rik
MMRRC Submission 042684-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5095 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location27689340-27706484 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 27693636 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076421] [ENSMUST00000120004]
Predicted Effect probably benign
Transcript: ENSMUST00000076421
SMART Domains Protein: ENSMUSP00000075755
Gene: ENSMUSG00000057093

DomainStartEndE-ValueType
KRAB 14 75 1.29e-35 SMART
ZnF_C2H2 172 194 1.08e-1 SMART
ZnF_C2H2 200 222 4.24e-4 SMART
ZnF_C2H2 228 250 2.2e-2 SMART
ZnF_C2H2 256 278 1.69e-3 SMART
ZnF_C2H2 284 306 4.94e-5 SMART
ZnF_C2H2 312 334 2.36e-2 SMART
ZnF_C2H2 339 361 1.18e-2 SMART
ZnF_C2H2 367 389 1.67e-2 SMART
ZnF_C2H2 395 417 1.38e-3 SMART
ZnF_C2H2 423 445 1.06e-4 SMART
ZnF_C2H2 451 473 1.67e-2 SMART
ZnF_C2H2 479 501 6.67e-2 SMART
ZnF_C2H2 507 529 3.52e-1 SMART
ZnF_C2H2 535 557 3.49e-5 SMART
ZnF_C2H2 563 585 1.56e-2 SMART
ZnF_C2H2 591 613 3.89e-3 SMART
ZnF_C2H2 619 641 9.73e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120004
SMART Domains Protein: ENSMUSP00000112494
Gene: ENSMUSG00000057093

DomainStartEndE-ValueType
KRAB 14 75 1.29e-35 SMART
ZnF_C2H2 172 194 1.08e-1 SMART
ZnF_C2H2 200 222 4.24e-4 SMART
ZnF_C2H2 228 250 2.2e-2 SMART
ZnF_C2H2 256 278 1.69e-3 SMART
ZnF_C2H2 284 306 4.94e-5 SMART
ZnF_C2H2 312 334 2.36e-2 SMART
ZnF_C2H2 339 361 1.18e-2 SMART
ZnF_C2H2 367 389 1.67e-2 SMART
ZnF_C2H2 395 417 1.38e-3 SMART
ZnF_C2H2 423 445 1.06e-4 SMART
ZnF_C2H2 451 473 1.67e-2 SMART
ZnF_C2H2 479 501 6.67e-2 SMART
ZnF_C2H2 507 529 3.52e-1 SMART
ZnF_C2H2 535 557 3.49e-5 SMART
ZnF_C2H2 563 585 1.56e-2 SMART
ZnF_C2H2 591 613 3.89e-3 SMART
ZnF_C2H2 619 641 9.73e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124397
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127200
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021A07Rik G C 10: 21,425,593 noncoding transcript Het
4932415D10Rik G T 10: 82,283,667 A4503E probably damaging Het
Adgrv1 C T 13: 81,095,487 V6265I probably benign Het
Agbl1 G A 7: 76,720,133 G660D probably damaging Het
Arap2 A G 5: 62,654,049 Y1140H probably damaging Het
Atp6v1c1 T C 15: 38,679,413 probably null Het
C1rb A T 6: 124,580,313 R470W possibly damaging Het
Caskin2 T C 11: 115,800,738 T1074A probably benign Het
Cdh19 T A 1: 110,954,661 T34S probably benign Het
Csnk1a1 T A 18: 61,575,476 Y175N probably damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Flt4 T A 11: 49,627,159 V342D possibly damaging Het
Frmd5 A T 2: 121,548,921 C394S possibly damaging Het
Gm5414 T G 15: 101,624,038 N550T probably benign Het
Hcn3 C A 3: 89,149,923 R456L probably damaging Het
Htt T C 5: 34,824,395 V893A possibly damaging Het
Ift46 A G 9: 44,786,849 D203G probably damaging Het
Itga10 G T 3: 96,648,164 V145L probably benign Het
Kcnh6 A G 11: 106,017,254 D232G possibly damaging Het
Mbtd1 T C 11: 93,929,671 S431P probably damaging Het
Mmp27 T A 9: 7,572,158 W120R probably damaging Het
Mmp27 A T 9: 7,579,000 D418V probably damaging Het
Myo5a A G 9: 75,152,020 D510G probably damaging Het
Myo5a A T 9: 75,184,389 K1179* probably null Het
Neto1 T C 18: 86,398,281 S38P probably benign Het
Nos3 A G 5: 24,368,918 probably benign Het
Nuggc C T 14: 65,635,090 R512* probably null Het
Oas1e T A 5: 120,794,264 K105* probably null Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr512 T C 7: 108,713,812 F141S probably damaging Het
Omd T A 13: 49,589,698 S75T possibly damaging Het
Pbrm1 A G 14: 31,032,530 N190S probably benign Het
Picalm T C 7: 90,170,633 F85L probably damaging Het
Polg A G 7: 79,460,300 V360A possibly damaging Het
Prex1 T C 2: 166,581,921 D1017G probably damaging Het
Prss56 G C 1: 87,188,111 R569P probably damaging Het
Rab6b G A 9: 103,140,384 G25R probably damaging Het
Rdh10 A G 1: 16,131,385 T332A probably benign Het
Rheb A T 5: 24,807,641 M115K probably benign Het
Rnf149 A T 1: 39,555,656 D321E probably benign Het
Rps28 C T 17: 33,823,203 probably null Het
Slc6a20b A G 9: 123,595,054 V616A probably benign Het
Smarcc2 A G 10: 128,469,300 K300R probably damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Srp68 C T 11: 116,248,747 V459M probably damaging Het
Stxbp4 C T 11: 90,548,975 V346I probably benign Het
Syne2 A G 12: 75,952,826 D2331G probably damaging Het
Ttn A T 2: 76,734,192 Y28534N probably damaging Het
Usp44 A T 10: 93,846,845 I386F possibly damaging Het
Vmn2r15 T C 5: 109,288,451 probably null Het
Vmn2r72 T A 7: 85,737,853 L834F probably damaging Het
Vps13b T A 15: 35,923,202 I3741K probably damaging Het
Zdbf2 A G 1: 63,309,073 T2204A possibly damaging Het
Other mutations in Zfp607b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02090:Zfp607b APN 7 27698715 missense possibly damaging 0.75
IGL02114:Zfp607b APN 7 27703725 missense probably benign 0.19
IGL03171:Zfp607b APN 7 27693595 missense possibly damaging 0.70
IGL03329:Zfp607b APN 7 27703870 missense probably damaging 1.00
R0988:Zfp607b UTSW 7 27702976 missense probably benign 0.34
R1518:Zfp607b UTSW 7 27698662 missense possibly damaging 0.95
R1672:Zfp607b UTSW 7 27692523 missense possibly damaging 0.86
R1733:Zfp607b UTSW 7 27692524 missense possibly damaging 0.66
R1992:Zfp607b UTSW 7 27702524 missense possibly damaging 0.87
R2849:Zfp607b UTSW 7 27702394 missense probably benign 0.00
R3879:Zfp607b UTSW 7 27704051 missense possibly damaging 0.91
R4117:Zfp607b UTSW 7 27698682 missense probably damaging 0.97
R4439:Zfp607b UTSW 7 27702724 missense probably damaging 1.00
R4610:Zfp607b UTSW 7 27703695 missense probably damaging 1.00
R4755:Zfp607b UTSW 7 27703505 missense probably damaging 1.00
R4909:Zfp607b UTSW 7 27703796 missense probably benign
R5301:Zfp607b UTSW 7 27703747 missense probably benign
R5422:Zfp607b UTSW 7 27702388 missense probably benign 0.00
R5538:Zfp607b UTSW 7 27702869 missense probably damaging 1.00
R5546:Zfp607b UTSW 7 27702607 missense probably benign 0.19
R5644:Zfp607b UTSW 7 27703769 missense probably damaging 1.00
R5649:Zfp607b UTSW 7 27703981 missense probably damaging 1.00
R5692:Zfp607b UTSW 7 27703464 missense probably benign 0.17
R5945:Zfp607b UTSW 7 27702416 missense probably benign 0.06
R6695:Zfp607b UTSW 7 27704039 missense probably benign 0.04
R7402:Zfp607b UTSW 7 27693494 missense probably damaging 1.00
R7515:Zfp607b UTSW 7 27703496 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGAAAGCTTCCCCAGTTTCAC -3'
(R):5'- CTTCCAAAGGTCCTTAGTTCAAATC -3'

Sequencing Primer
(F):5'- AAAGCTTCCCCAGTTTCACTCTCC -3'
(R):5'- AGGTCCTTAGTTCAAATCCCAGC -3'
Posted On2016-06-21