Mutagenetix > Incidental Mutations

Incidental Mutation 'R5095:Agbl1'

395818

Institutional Source

Beutler Lab

Gene Symbol

Agbl1

Ensembl Gene

ENSMUSG00000025754

Gene Name

ATP/GTP binding protein-like 1

Synonyms

Nna1-l1, EG244071

MMRRC Submission

042684-MU

Accession Numbers

Ncbi RefSeq: NM_001199224.1; MGI:3646469

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5095 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76229887-77124698 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 76720133 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 660 (G660D)

Ref Sequence

ENSEMBL: ENSMUSP00000103066 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107442] [ENSMUST00000156166]

Predicted Effect

probably damaging
Transcript: ENSMUST00000107442
AA Change: G660D

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000103066
Gene: ENSMUSG00000025754
AA Change: G660D

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Pfam:Peptidase_M14	494	754	3.1e-27	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000156166
AA Change: G912D

SMART Domains

Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754
AA Change: G912D

Domain	Start	End	E-Value	Type
low complexity region	254	270	N/A	INTRINSIC

Meta Mutation Damage Score

0.2302

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021A07Rik	G	C	10: 21,425,593		noncoding transcript	Het
4932415D10Rik	G	T	10: 82,283,667	A4503E	probably damaging	Het
Adgrv1	C	T	13: 81,095,487	V6265I	probably benign	Het
Arap2	A	G	5: 62,654,049	Y1140H	probably damaging	Het
Atp6v1c1	T	C	15: 38,679,413		probably null	Het
C1rb	A	T	6: 124,580,313	R470W	possibly damaging	Het
Caskin2	T	C	11: 115,800,738	T1074A	probably benign	Het
Cdh19	T	A	1: 110,954,661	T34S	probably benign	Het
Csnk1a1	T	A	18: 61,575,476	Y175N	probably damaging	Het
F2	CAGAAAG	CAG	2: 91,634,957		probably benign	Het
Flt4	T	A	11: 49,627,159	V342D	possibly damaging	Het
Frmd5	A	T	2: 121,548,921	C394S	possibly damaging	Het
Gm5414	T	G	15: 101,624,038	N550T	probably benign	Het
Hcn3	C	A	3: 89,149,923	R456L	probably damaging	Het
Htt	T	C	5: 34,824,395	V893A	possibly damaging	Het
Ift46	A	G	9: 44,786,849	D203G	probably damaging	Het
Itga10	G	T	3: 96,648,164	V145L	probably benign	Het
Kcnh6	A	G	11: 106,017,254	D232G	possibly damaging	Het
Mbtd1	T	C	11: 93,929,671	S431P	probably damaging	Het
Mmp27	T	A	9: 7,572,158	W120R	probably damaging	Het
Mmp27	A	T	9: 7,579,000	D418V	probably damaging	Het
Myo5a	A	G	9: 75,152,020	D510G	probably damaging	Het
Myo5a	A	T	9: 75,184,389	K1179*	probably null	Het
Neto1	T	C	18: 86,398,281	S38P	probably benign	Het
Nos3	A	G	5: 24,368,918		probably benign	Het
Nuggc	C	T	14: 65,635,090	R512*	probably null	Het
Oas1e	T	A	5: 120,794,264	K105*	probably null	Het
Olfr135	A	C	17: 38,208,317	E24A	possibly damaging	Het
Olfr512	T	C	7: 108,713,812	F141S	probably damaging	Het
Omd	T	A	13: 49,589,698	S75T	possibly damaging	Het
Pbrm1	A	G	14: 31,032,530	N190S	probably benign	Het
Picalm	T	C	7: 90,170,633	F85L	probably damaging	Het
Polg	A	G	7: 79,460,300	V360A	possibly damaging	Het
Prex1	T	C	2: 166,581,921	D1017G	probably damaging	Het
Prss56	G	C	1: 87,188,111	R569P	probably damaging	Het
Rab6b	G	A	9: 103,140,384	G25R	probably damaging	Het
Rdh10	A	G	1: 16,131,385	T332A	probably benign	Het
Rheb	A	T	5: 24,807,641	M115K	probably benign	Het
Rnf149	A	T	1: 39,555,656	D321E	probably benign	Het
Rps28	C	T	17: 33,823,203		probably null	Het
Slc6a20b	A	G	9: 123,595,054	V616A	probably benign	Het
Smarcc2	A	G	10: 128,469,300	K300R	probably damaging	Het
Sparcl1	C	T	5: 104,085,763	M573I	probably damaging	Het
Srp68	C	T	11: 116,248,747	V459M	probably damaging	Het
Stxbp4	C	T	11: 90,548,975	V346I	probably benign	Het
Syne2	A	G	12: 75,952,826	D2331G	probably damaging	Het
Ttn	A	T	2: 76,734,192	Y28534N	probably damaging	Het
Usp44	A	T	10: 93,846,845	I386F	possibly damaging	Het
Vmn2r15	T	C	5: 109,288,451		probably null	Het
Vmn2r72	T	A	7: 85,737,853	L834F	probably damaging	Het
Vps13b	T	A	15: 35,923,202	I3741K	probably damaging	Het
Zdbf2	A	G	1: 63,309,073	T2204A	possibly damaging	Het
Zfp607b	T	A	7: 27,693,636		probably benign	Het

Other mutations in Agbl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01567:Agbl1	APN	7	76421880	missense	probably benign	0.01
IGL01650:Agbl1	APN	7	76420319	missense	probably damaging	1.00
IGL02244:Agbl1	APN	7	76766372	missense	probably damaging	1.00
IGL03088:Agbl1	APN	7	76720142	missense	probably benign	0.12
IGL03143:Agbl1	APN	7	76420045	nonsense	probably null
IGL03306:Agbl1	APN	7	76589504	missense	probably damaging	1.00
R0001:Agbl1	UTSW	7	76419863	missense	probably damaging	0.98
R0045:Agbl1	UTSW	7	76698840	critical splice donor site	probably null
R0045:Agbl1	UTSW	7	76698840	critical splice donor site	probably null
R0541:Agbl1	UTSW	7	76409245	missense	probably benign	0.22
R1889:Agbl1	UTSW	7	76589381	missense	probably damaging	1.00
R2089:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2091:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2091:Agbl1	UTSW	7	76589500	missense	probably damaging	0.98
R2127:Agbl1	UTSW	7	76419880	missense	possibly damaging	0.64
R2148:Agbl1	UTSW	7	76414717	splice site	probably null
R2229:Agbl1	UTSW	7	76433378	missense	probably benign	0.43
R2243:Agbl1	UTSW	7	76418722	missense	possibly damaging	0.93
R2255:Agbl1	UTSW	7	76422184	missense	probably damaging	1.00
R2411:Agbl1	UTSW	7	76720150	missense	probably damaging	1.00
R2426:Agbl1	UTSW	7	76421902	missense	probably damaging	1.00
R2508:Agbl1	UTSW	7	76589550	critical splice donor site	probably null
R2910:Agbl1	UTSW	7	76419838	missense	probably benign	0.13
R2919:Agbl1	UTSW	7	76414658	missense	probably damaging	1.00
R3056:Agbl1	UTSW	7	76766484	missense	possibly damaging	0.60
R3153:Agbl1	UTSW	7	76720196	missense	probably damaging	1.00
R3770:Agbl1	UTSW	7	76425929	critical splice donor site	probably null
R3825:Agbl1	UTSW	7	76419967	missense	probably damaging	0.99
R4632:Agbl1	UTSW	7	76413685	missense	probably benign	0.00
R4857:Agbl1	UTSW	7	76419835	missense	probably benign	0.03
R4943:Agbl1	UTSW	7	76420016	missense	probably benign	0.01
R5055:Agbl1	UTSW	7	76413577	missense	probably damaging	1.00
R5071:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5072:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5074:Agbl1	UTSW	7	76421917	missense	probably damaging	1.00
R5133:Agbl1	UTSW	7	76422156	missense	probably benign	0.21
R5576:Agbl1	UTSW	7	76335237	missense	probably benign	0.03
R5665:Agbl1	UTSW	7	76589503	missense	probably damaging	1.00
R5849:Agbl1	UTSW	7	76325098	missense	probably benign	0.35
R5924:Agbl1	UTSW	7	76409234	missense	probably benign	0.12
R6044:Agbl1	UTSW	7	76318120	missense	possibly damaging	0.56
R6117:Agbl1	UTSW	7	76698786	missense	probably damaging	1.00
R6144:Agbl1	UTSW	7	76420084	missense	probably benign	0.02
R6368:Agbl1	UTSW	7	76419830	missense	probably benign	0.25
R6806:Agbl1	UTSW	7	76425921	missense	probably damaging	1.00
R7455:Agbl1	UTSW	7	76424755	missense	unknown
R7459:Agbl1	UTSW	7	76420066	missense	not run
R7485:Agbl1	UTSW	7	76589493	missense	unknown
R7516:Agbl1	UTSW	7	76425921	missense	probably damaging	1.00
R7539:Agbl1	UTSW	7	76425929	critical splice donor site	probably null
R7561:Agbl1	UTSW	7	76698761	missense	unknown
R7630:Agbl1	UTSW	7	76886156	missense	unknown
R7655:Agbl1	UTSW	7	76409332	missense
R7656:Agbl1	UTSW	7	76409332	missense
R7658:Agbl1	UTSW	7	76766369	missense	unknown
R7681:Agbl1	UTSW	7	76444901	missense	unknown
R7694:Agbl1	UTSW	7	76698765	missense	unknown
R7773:Agbl1	UTSW	7	76698837	missense	unknown
Z1088:Agbl1	UTSW	7	76419904	missense	probably benign	0.00
Z1176:Agbl1	UTSW	7	76418685	missense
Z1177:Agbl1	UTSW	7	76720206	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CTGTTGCTATACCAGTACCATACAG -3'
(R):5'- ATAGGTCAGTGGTAAAGCTTCTG -3'

Sequencing Primer
(F):5'- ATCACAATTGCTCTGTAGTACAGC -3'
(R):5'- CAGTGGTAAAGCTTCTGTTTACAAAC -3'

Posted On

2016-06-21