Incidental Mutation 'R5095:Slc6a20b'
ID395829
Institutional Source Beutler Lab
Gene Symbol Slc6a20b
Ensembl Gene ENSMUSG00000025243
Gene Namesolute carrier family 6 (neurotransmitter transporter), member 20B
SynonymsSit1, XT3, Xtrp3, Slc6a20
MMRRC Submission 042684-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5095 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location123590800-123632565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123595054 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 616 (V616A)
Ref Sequence ENSEMBL: ENSMUSP00000026273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026270] [ENSMUST00000026273] [ENSMUST00000166800]
Predicted Effect probably benign
Transcript: ENSMUST00000026270
SMART Domains Protein: ENSMUSP00000026270
Gene: ENSMUSG00000025240

DomainStartEndE-ValueType
Pfam:Syja_N 58 346 4.7e-88 PFAM
low complexity region 400 415 N/A INTRINSIC
Blast:IPPc 416 500 3e-12 BLAST
transmembrane domain 521 543 N/A INTRINSIC
transmembrane domain 550 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026273
AA Change: V616A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026273
Gene: ENSMUSG00000025243
AA Change: V616A

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
Pfam:SNF 48 624 5.4e-173 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166800
Predicted Effect probably benign
Transcript: ENSMUST00000168824
SMART Domains Protein: ENSMUSP00000129307
Gene: ENSMUSG00000025243

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:SNF 38 74 3.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217089
Meta Mutation Damage Score 0.1116 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021A07Rik G C 10: 21,425,593 noncoding transcript Het
4932415D10Rik G T 10: 82,283,667 A4503E probably damaging Het
Adgrv1 C T 13: 81,095,487 V6265I probably benign Het
Agbl1 G A 7: 76,720,133 G660D probably damaging Het
Arap2 A G 5: 62,654,049 Y1140H probably damaging Het
Atp6v1c1 T C 15: 38,679,413 probably null Het
C1rb A T 6: 124,580,313 R470W possibly damaging Het
Caskin2 T C 11: 115,800,738 T1074A probably benign Het
Cdh19 T A 1: 110,954,661 T34S probably benign Het
Csnk1a1 T A 18: 61,575,476 Y175N probably damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Flt4 T A 11: 49,627,159 V342D possibly damaging Het
Frmd5 A T 2: 121,548,921 C394S possibly damaging Het
Gm5414 T G 15: 101,624,038 N550T probably benign Het
Hcn3 C A 3: 89,149,923 R456L probably damaging Het
Htt T C 5: 34,824,395 V893A possibly damaging Het
Ift46 A G 9: 44,786,849 D203G probably damaging Het
Itga10 G T 3: 96,648,164 V145L probably benign Het
Kcnh6 A G 11: 106,017,254 D232G possibly damaging Het
Mbtd1 T C 11: 93,929,671 S431P probably damaging Het
Mmp27 T A 9: 7,572,158 W120R probably damaging Het
Mmp27 A T 9: 7,579,000 D418V probably damaging Het
Myo5a A G 9: 75,152,020 D510G probably damaging Het
Myo5a A T 9: 75,184,389 K1179* probably null Het
Neto1 T C 18: 86,398,281 S38P probably benign Het
Nos3 A G 5: 24,368,918 probably benign Het
Nuggc C T 14: 65,635,090 R512* probably null Het
Oas1e T A 5: 120,794,264 K105* probably null Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr512 T C 7: 108,713,812 F141S probably damaging Het
Omd T A 13: 49,589,698 S75T possibly damaging Het
Pbrm1 A G 14: 31,032,530 N190S probably benign Het
Picalm T C 7: 90,170,633 F85L probably damaging Het
Polg A G 7: 79,460,300 V360A possibly damaging Het
Prex1 T C 2: 166,581,921 D1017G probably damaging Het
Prss56 G C 1: 87,188,111 R569P probably damaging Het
Rab6b G A 9: 103,140,384 G25R probably damaging Het
Rdh10 A G 1: 16,131,385 T332A probably benign Het
Rheb A T 5: 24,807,641 M115K probably benign Het
Rnf149 A T 1: 39,555,656 D321E probably benign Het
Rps28 C T 17: 33,823,203 probably null Het
Smarcc2 A G 10: 128,469,300 K300R probably damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Srp68 C T 11: 116,248,747 V459M probably damaging Het
Stxbp4 C T 11: 90,548,975 V346I probably benign Het
Syne2 A G 12: 75,952,826 D2331G probably damaging Het
Ttn A T 2: 76,734,192 Y28534N probably damaging Het
Usp44 A T 10: 93,846,845 I386F possibly damaging Het
Vmn2r15 T C 5: 109,288,451 probably null Het
Vmn2r72 T A 7: 85,737,853 L834F probably damaging Het
Vps13b T A 15: 35,923,202 I3741K probably damaging Het
Zdbf2 A G 1: 63,309,073 T2204A possibly damaging Het
Zfp607b T A 7: 27,693,636 probably benign Het
Other mutations in Slc6a20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02430:Slc6a20b APN 9 123597240 missense probably damaging 1.00
IGL02741:Slc6a20b APN 9 123607602 missense probably damaging 1.00
IGL03038:Slc6a20b APN 9 123597329 missense possibly damaging 0.55
IGL03115:Slc6a20b APN 9 123597338 missense possibly damaging 0.82
IGL03228:Slc6a20b APN 9 123632132 nonsense probably null
PIT4131001:Slc6a20b UTSW 9 123612126 missense probably benign 0.00
R0653:Slc6a20b UTSW 9 123597312 missense probably damaging 1.00
R1072:Slc6a20b UTSW 9 123598459 missense probably damaging 0.97
R1759:Slc6a20b UTSW 9 123608997 critical splice donor site probably null
R1889:Slc6a20b UTSW 9 123632204 missense probably benign 0.02
R2075:Slc6a20b UTSW 9 123595034 missense probably benign 0.13
R2187:Slc6a20b UTSW 9 123598588 missense probably damaging 1.00
R4097:Slc6a20b UTSW 9 123612757 utr 3 prime probably benign
R4762:Slc6a20b UTSW 9 123598560 missense probably damaging 1.00
R4834:Slc6a20b UTSW 9 123596048 missense probably benign 0.00
R4932:Slc6a20b UTSW 9 123604796 missense probably damaging 1.00
R5079:Slc6a20b UTSW 9 123598498 missense probably damaging 1.00
R5307:Slc6a20b UTSW 9 123603834 missense possibly damaging 0.62
R5721:Slc6a20b UTSW 9 123611989 missense probably null 1.00
R6108:Slc6a20b UTSW 9 123596186 missense probably benign 0.01
R6285:Slc6a20b UTSW 9 123609096 missense possibly damaging 0.81
R6463:Slc6a20b UTSW 9 123604949 missense possibly damaging 0.62
R7050:Slc6a20b UTSW 9 123598543 missense probably damaging 1.00
R7411:Slc6a20b UTSW 9 123604948 missense probably benign 0.32
R7422:Slc6a20b UTSW 9 123607617 missense possibly damaging 0.95
R7460:Slc6a20b UTSW 9 123604949 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCTTGCAGATTCAGGAAGCAG -3'
(R):5'- GTGTATGGCTGACCTACAGG -3'

Sequencing Primer
(F):5'- TTCAGGAAGCAGAAAATACTTGTGGC -3'
(R):5'- AGGTCAATCCACGATATCTTGGC -3'
Posted On2016-06-21