Mutagenetix > Incidental Mutation

Incidental Mutation 'R5095:Stxbp4'

395835

Institutional Source

Beutler Lab

Gene Symbol

Stxbp4

Ensembl Gene

ENSMUSG00000020546

Gene Name

syntaxin binding protein 4

Synonyms

Synip, 6030470M02Rik

MMRRC Submission

042684-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5095 (G1)

Quality Score

219

Status

Validated

Chromosome

Chromosomal Location

90476492-90638084 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 90548975 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 346 (V346I)

Ref Sequence

ENSEMBL: ENSMUSP00000116191 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020858] [ENSMUST00000143203]

AlphaFold

Q9WV89

Predicted Effect

probably benign
Transcript: ENSMUST00000020858
AA Change: V346I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000020858
Gene: ENSMUSG00000020546
AA Change: V346I

Domain	Start	End	E-Value	Type
PDZ	29	109	6.13e-10	SMART
low complexity region	131	154	N/A	INTRINSIC
coiled coil region	298	409	N/A	INTRINSIC
low complexity region	504	522	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123260

SMART Domains

Protein: ENSMUSP00000122365
Gene: ENSMUSG00000020546

Domain	Start	End	E-Value	Type
coiled coil region	3	42	N/A	INTRINSIC
SCOP:d1i5hw_	132	153	6e-7	SMART
Blast:WW	135	153	3e-7	BLAST
PDB:2YSG\|A	136	153	4e-7	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000143203
AA Change: V346I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000116191
Gene: ENSMUSG00000020546
AA Change: V346I

Domain	Start	End	E-Value	Type
PDZ	29	109	6.13e-10	SMART
low complexity region	131	154	N/A	INTRINSIC
coiled coil region	298	409	N/A	INTRINSIC
WW	501	533	1.11e-10	SMART

Meta Mutation Damage Score

0.0580

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

98% (59/60)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021A07Rik	G	C	10: 21,425,593		noncoding transcript	Het
4932415D10Rik	G	T	10: 82,283,667	A4503E	probably damaging	Het
Adgrv1	C	T	13: 81,095,487	V6265I	probably benign	Het
Agbl1	G	A	7: 76,720,133	G660D	probably damaging	Het
Arap2	A	G	5: 62,654,049	Y1140H	probably damaging	Het
Atp6v1c1	T	C	15: 38,679,413		probably null	Het
C1rb	A	T	6: 124,580,313	R470W	possibly damaging	Het
Caskin2	T	C	11: 115,800,738	T1074A	probably benign	Het
Cdh19	T	A	1: 110,954,661	T34S	probably benign	Het
Csnk1a1	T	A	18: 61,575,476	Y175N	probably damaging	Het
F2	CAGAAAG	CAG	2: 91,634,957		probably benign	Het
Flt4	T	A	11: 49,627,159	V342D	possibly damaging	Het
Frmd5	A	T	2: 121,548,921	C394S	possibly damaging	Het
Gm5414	T	G	15: 101,624,038	N550T	probably benign	Het
Hcn3	C	A	3: 89,149,923	R456L	probably damaging	Het
Htt	T	C	5: 34,824,395	V893A	possibly damaging	Het
Ift46	A	G	9: 44,786,849	D203G	probably damaging	Het
Itga10	G	T	3: 96,648,164	V145L	probably benign	Het
Kcnh6	A	G	11: 106,017,254	D232G	possibly damaging	Het
Mbtd1	T	C	11: 93,929,671	S431P	probably damaging	Het
Mmp27	T	A	9: 7,572,158	W120R	probably damaging	Het
Mmp27	A	T	9: 7,579,000	D418V	probably damaging	Het
Myo5a	A	G	9: 75,152,020	D510G	probably damaging	Het
Myo5a	A	T	9: 75,184,389	K1179*	probably null	Het
Neto1	T	C	18: 86,398,281	S38P	probably benign	Het
Nos3	A	G	5: 24,368,918		probably benign	Het
Nuggc	C	T	14: 65,635,090	R512*	probably null	Het
Oas1e	T	A	5: 120,794,264	K105*	probably null	Het
Olfr135	A	C	17: 38,208,317	E24A	possibly damaging	Het
Olfr512	T	C	7: 108,713,812	F141S	probably damaging	Het
Omd	T	A	13: 49,589,698	S75T	possibly damaging	Het
Pbrm1	A	G	14: 31,032,530	N190S	probably benign	Het
Picalm	T	C	7: 90,170,633	F85L	probably damaging	Het
Polg	A	G	7: 79,460,300	V360A	possibly damaging	Het
Prex1	T	C	2: 166,581,921	D1017G	probably damaging	Het
Prss56	G	C	1: 87,188,111	R569P	probably damaging	Het
Rab6b	G	A	9: 103,140,384	G25R	probably damaging	Het
Rdh10	A	G	1: 16,131,385	T332A	probably benign	Het
Rheb	A	T	5: 24,807,641	M115K	probably benign	Het
Rnf149	A	T	1: 39,555,656	D321E	probably benign	Het
Rps28	C	T	17: 33,823,203		probably null	Het
Slc6a20b	A	G	9: 123,595,054	V616A	probably benign	Het
Smarcc2	A	G	10: 128,469,300	K300R	probably damaging	Het
Sparcl1	C	T	5: 104,085,763	M573I	probably damaging	Het
Srp68	C	T	11: 116,248,747	V459M	probably damaging	Het
Syne2	A	G	12: 75,952,826	D2331G	probably damaging	Het
Ttn	A	T	2: 76,734,192	Y28534N	probably damaging	Het
Usp44	A	T	10: 93,846,845	I386F	possibly damaging	Het
Vmn2r15	T	C	5: 109,288,451		probably null	Het
Vmn2r72	T	A	7: 85,737,853	L834F	probably damaging	Het
Vps13b	T	A	15: 35,923,202	I3741K	probably damaging	Het
Zdbf2	A	G	1: 63,309,073	T2204A	possibly damaging	Het
Zfp607b	T	A	7: 27,693,636		probably benign	Het

Other mutations in Stxbp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00988:Stxbp4	APN	11	90535512	missense	probably benign	0.00
IGL01312:Stxbp4	APN	11	90621649	splice site	probably benign
IGL01313:Stxbp4	APN	11	90621649	splice site	probably benign
IGL01314:Stxbp4	APN	11	90621649	splice site	probably benign
IGL01316:Stxbp4	APN	11	90621649	splice site	probably benign
IGL01377:Stxbp4	APN	11	90621649	splice site	probably benign
IGL01380:Stxbp4	APN	11	90621649	splice site	probably benign
IGL01385:Stxbp4	APN	11	90540248	missense	possibly damaging	0.95
IGL01408:Stxbp4	APN	11	90621649	splice site	probably benign
IGL02573:Stxbp4	APN	11	90540269	missense	probably damaging	0.99
IGL02707:Stxbp4	APN	11	90537933	missense	probably benign	0.00
IGL02809:Stxbp4	APN	11	90600184	critical splice donor site	probably null
IGL02900:Stxbp4	APN	11	90607035	missense	probably benign	0.03
IGL03177:Stxbp4	APN	11	90571753	missense	probably benign	0.01
IGL03397:Stxbp4	APN	11	90540234	missense	probably damaging	1.00
IGL02799:Stxbp4	UTSW	11	90494600	critical splice donor site	probably null
IGL03134:Stxbp4	UTSW	11	90607184	missense	probably damaging	0.98
R0005:Stxbp4	UTSW	11	90548917	missense	possibly damaging	0.78
R0487:Stxbp4	UTSW	11	90592360	missense	probably benign	0.00
R0930:Stxbp4	UTSW	11	90621700	start codon destroyed	probably null	0.99
R1633:Stxbp4	UTSW	11	90540160	splice site	probably benign
R3785:Stxbp4	UTSW	11	90535615	critical splice acceptor site	probably null
R4359:Stxbp4	UTSW	11	90494644	nonsense	probably null
R4591:Stxbp4	UTSW	11	90594780	missense	probably benign	0.33
R4756:Stxbp4	UTSW	11	90607371	missense	probably damaging	1.00
R5870:Stxbp4	UTSW	11	90537956	missense	possibly damaging	0.89
R6268:Stxbp4	UTSW	11	90540201	nonsense	probably null
R6460:Stxbp4	UTSW	11	90606985	missense	probably benign	0.35
R6479:Stxbp4	UTSW	11	90619187	missense	probably damaging	0.99
R7139:Stxbp4	UTSW	11	90607009	nonsense	probably null
R7349:Stxbp4	UTSW	11	90592111	splice site	probably null
R7481:Stxbp4	UTSW	11	90594813	missense	possibly damaging	0.94
R7812:Stxbp4	UTSW	11	90594828	missense	probably damaging	1.00
R8903:Stxbp4	UTSW	11	90535441	missense	unknown
R9023:Stxbp4	UTSW	11	90535423	missense	unknown
R9100:Stxbp4	UTSW	11	90535494	missense	possibly damaging	0.77
V8831:Stxbp4	UTSW	11	90480671	missense	probably benign	0.34
Z1176:Stxbp4	UTSW	11	90480671	missense	probably benign	0.34
Z1177:Stxbp4	UTSW	11	90480671	missense	probably benign	0.34
Z1177:Stxbp4	UTSW	11	90592331	critical splice donor site	probably null
Z1177:Stxbp4	UTSW	11	90600146	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGACCTAGTTAGGACGTGCAG -3'
(R):5'- TTCAGGAAACAAACAAAAGGGTTCC -3'

Sequencing Primer
(F):5'- TAACCAGAGAGGGCTGTTTGCTTAC -3'
(R):5'- CTGTCAACTGGAGAAGTCT -3'

Posted On

2016-06-21