Incidental Mutation 'R5095:Mbtd1'
ID395836
Institutional Source Beutler Lab
Gene Symbol Mbtd1
Ensembl Gene ENSMUSG00000059474
Gene Namembt domain containing 1
Synonymshemp
MMRRC Submission 042684-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5095 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location93885852-93946985 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93929671 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 431 (S431P)
Ref Sequence ENSEMBL: ENSMUSP00000070248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063645] [ENSMUST00000063718] [ENSMUST00000107852] [ENSMUST00000107853] [ENSMUST00000107854]
Predicted Effect probably damaging
Transcript: ENSMUST00000063645
AA Change: S431P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070248
Gene: ENSMUSG00000059474
AA Change: S431P

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 7e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 3.11e-22 SMART
MBT 256 357 1.28e-41 SMART
MBT 361 459 1.61e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000063718
AA Change: S453P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065442
Gene: ENSMUSG00000059474
AA Change: S453P

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
PDB:2W0T|A 74 96 7e-6 PDB
low complexity region 97 112 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
MBT 166 270 3.11e-22 SMART
MBT 278 379 1.28e-41 SMART
MBT 383 481 1.61e-38 SMART
MBT 489 585 4.11e-54 SMART
low complexity region 586 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107852
SMART Domains Protein: ENSMUSP00000103484
Gene: ENSMUSG00000059474

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 5e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 3.11e-22 SMART
MBT 256 357 1.28e-41 SMART
MBT 361 433 1.29e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107853
AA Change: S431P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103485
Gene: ENSMUSG00000059474
AA Change: S431P

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 1e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 1.2e-24 SMART
MBT 256 357 4.8e-44 SMART
MBT 361 459 6.1e-41 SMART
MBT 467 563 1.6e-56 SMART
low complexity region 564 592 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107854
AA Change: S431P

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103486
Gene: ENSMUSG00000059474
AA Change: S431P

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 1e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 1.2e-24 SMART
MBT 256 357 4.9e-44 SMART
MBT 361 459 6.2e-41 SMART
MBT 467 563 1.6e-56 SMART
low complexity region 564 592 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155841
Meta Mutation Damage Score 0.2075 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality and severe abnormalities in hematopoietic stem cell function and skeletal formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021A07Rik G C 10: 21,425,593 noncoding transcript Het
4932415D10Rik G T 10: 82,283,667 A4503E probably damaging Het
Adgrv1 C T 13: 81,095,487 V6265I probably benign Het
Agbl1 G A 7: 76,720,133 G660D probably damaging Het
Arap2 A G 5: 62,654,049 Y1140H probably damaging Het
Atp6v1c1 T C 15: 38,679,413 probably null Het
C1rb A T 6: 124,580,313 R470W possibly damaging Het
Caskin2 T C 11: 115,800,738 T1074A probably benign Het
Cdh19 T A 1: 110,954,661 T34S probably benign Het
Csnk1a1 T A 18: 61,575,476 Y175N probably damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Flt4 T A 11: 49,627,159 V342D possibly damaging Het
Frmd5 A T 2: 121,548,921 C394S possibly damaging Het
Gm5414 T G 15: 101,624,038 N550T probably benign Het
Hcn3 C A 3: 89,149,923 R456L probably damaging Het
Htt T C 5: 34,824,395 V893A possibly damaging Het
Ift46 A G 9: 44,786,849 D203G probably damaging Het
Itga10 G T 3: 96,648,164 V145L probably benign Het
Kcnh6 A G 11: 106,017,254 D232G possibly damaging Het
Mmp27 T A 9: 7,572,158 W120R probably damaging Het
Mmp27 A T 9: 7,579,000 D418V probably damaging Het
Myo5a A G 9: 75,152,020 D510G probably damaging Het
Myo5a A T 9: 75,184,389 K1179* probably null Het
Neto1 T C 18: 86,398,281 S38P probably benign Het
Nos3 A G 5: 24,368,918 probably benign Het
Nuggc C T 14: 65,635,090 R512* probably null Het
Oas1e T A 5: 120,794,264 K105* probably null Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr512 T C 7: 108,713,812 F141S probably damaging Het
Omd T A 13: 49,589,698 S75T possibly damaging Het
Pbrm1 A G 14: 31,032,530 N190S probably benign Het
Picalm T C 7: 90,170,633 F85L probably damaging Het
Polg A G 7: 79,460,300 V360A possibly damaging Het
Prex1 T C 2: 166,581,921 D1017G probably damaging Het
Prss56 G C 1: 87,188,111 R569P probably damaging Het
Rab6b G A 9: 103,140,384 G25R probably damaging Het
Rdh10 A G 1: 16,131,385 T332A probably benign Het
Rheb A T 5: 24,807,641 M115K probably benign Het
Rnf149 A T 1: 39,555,656 D321E probably benign Het
Rps28 C T 17: 33,823,203 probably null Het
Slc6a20b A G 9: 123,595,054 V616A probably benign Het
Smarcc2 A G 10: 128,469,300 K300R probably damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Srp68 C T 11: 116,248,747 V459M probably damaging Het
Stxbp4 C T 11: 90,548,975 V346I probably benign Het
Syne2 A G 12: 75,952,826 D2331G probably damaging Het
Ttn A T 2: 76,734,192 Y28534N probably damaging Het
Usp44 A T 10: 93,846,845 I386F possibly damaging Het
Vmn2r15 T C 5: 109,288,451 probably null Het
Vmn2r72 T A 7: 85,737,853 L834F probably damaging Het
Vps13b T A 15: 35,923,202 I3741K probably damaging Het
Zdbf2 A G 1: 63,309,073 T2204A possibly damaging Het
Zfp607b T A 7: 27,693,636 probably benign Het
Other mutations in Mbtd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Mbtd1 APN 11 93943840 missense possibly damaging 0.94
IGL00819:Mbtd1 APN 11 93931811 critical splice acceptor site probably null
IGL01140:Mbtd1 APN 11 93924432 missense probably damaging 1.00
IGL01553:Mbtd1 APN 11 93923214 missense probably benign 0.35
IGL01893:Mbtd1 APN 11 93921412 missense probably null
IGL02218:Mbtd1 APN 11 93931803 splice site probably benign
IGL02406:Mbtd1 APN 11 93908858 missense probably damaging 1.00
IGL03002:Mbtd1 APN 11 93924490 missense probably benign 0.15
IGL03347:Mbtd1 APN 11 93923179 missense probably benign 0.01
R0027:Mbtd1 UTSW 11 93924549 missense possibly damaging 0.85
R0027:Mbtd1 UTSW 11 93924549 missense possibly damaging 0.85
R0311:Mbtd1 UTSW 11 93921357 splice site probably null
R0513:Mbtd1 UTSW 11 93932212 splice site probably null
R0646:Mbtd1 UTSW 11 93905212 missense probably damaging 1.00
R0734:Mbtd1 UTSW 11 93923146 missense probably damaging 1.00
R0835:Mbtd1 UTSW 11 93931839 missense probably benign 0.23
R1295:Mbtd1 UTSW 11 93910359 missense probably damaging 0.99
R1296:Mbtd1 UTSW 11 93910359 missense probably damaging 0.99
R1996:Mbtd1 UTSW 11 93932396 frame shift probably null
R2157:Mbtd1 UTSW 11 93910388 missense probably benign 0.20
R3977:Mbtd1 UTSW 11 93905175 missense probably benign
R4435:Mbtd1 UTSW 11 93932222 missense probably benign
R4589:Mbtd1 UTSW 11 93921419 missense probably damaging 1.00
R4647:Mbtd1 UTSW 11 93924611 missense probably damaging 1.00
R4824:Mbtd1 UTSW 11 93925702 missense probably benign 0.00
R4919:Mbtd1 UTSW 11 93923148 unclassified probably null
R5045:Mbtd1 UTSW 11 93931815 missense probably benign 0.26
R5227:Mbtd1 UTSW 11 93924648 missense possibly damaging 0.54
R5619:Mbtd1 UTSW 11 93929879 intron probably null
R6057:Mbtd1 UTSW 11 93929659 missense probably damaging 0.99
R6293:Mbtd1 UTSW 11 93932232 missense possibly damaging 0.79
R6294:Mbtd1 UTSW 11 93932232 missense possibly damaging 0.79
R6295:Mbtd1 UTSW 11 93932232 missense possibly damaging 0.79
R6297:Mbtd1 UTSW 11 93932232 missense possibly damaging 0.79
R6998:Mbtd1 UTSW 11 93924612 missense probably damaging 1.00
R7423:Mbtd1 UTSW 11 93943796 missense probably benign 0.38
R7519:Mbtd1 UTSW 11 93908899 missense probably damaging 1.00
X0024:Mbtd1 UTSW 11 93924549 missense possibly damaging 0.85
Z1177:Mbtd1 UTSW 11 93912459 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCAAGCATCTTAAGTCATCCCTTTG -3'
(R):5'- CGTACAACAACTAAGATTAGGGC -3'

Sequencing Primer
(F):5'- GCATCTTAAGTCATCCCTTTGTAAAC -3'
(R):5'- TTAGGGCTATGTTAAATGTAAGCAG -3'
Posted On2016-06-21