Mutagenetix > Incidental Mutation

Incidental Mutation 'R5095:Kcnh6'

395837

Institutional Source

Beutler Lab

Gene Symbol

Kcnh6

Ensembl Gene

ENSMUSG00000001901

Gene Name

potassium voltage-gated channel, subfamily H (eag-related), member 6

Synonyms

m-erg2

MMRRC Submission

042684-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5095 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106008124-106034549 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106017254 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 232 (D232G)

Ref Sequence

ENSEMBL: ENSMUSP00000137675 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001965] [ENSMUST00000106903] [ENSMUST00000145539]

AlphaFold

Q32ME0

Predicted Effect

probably benign
Transcript: ENSMUST00000001965
AA Change: D232G

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000001965
Gene: ENSMUSG00000001901
AA Change: D232G

Domain	Start	End	E-Value	Type
Blast:PAS	13	87	2e-43	BLAST
PAC	93	135	4.06e-2	SMART
low complexity region	139	152	N/A	INTRINSIC
low complexity region	158	173	N/A	INTRINSIC
Pfam:Ion_trans	256	523	6.8e-40	PFAM
Pfam:Ion_trans_2	445	517	2.6e-13	PFAM
cNMP	594	712	3.21e-23	SMART
coiled coil region	782	809	N/A	INTRINSIC
low complexity region	901	912	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106903
AA Change: D232G

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000102516
Gene: ENSMUSG00000001901
AA Change: D232G

Domain	Start	End	E-Value	Type
Blast:PAS	13	87	3e-43	BLAST
PAC	93	135	4.06e-2	SMART
low complexity region	139	152	N/A	INTRINSIC
low complexity region	158	173	N/A	INTRINSIC
transmembrane domain	258	280	N/A	INTRINSIC
Pfam:Ion_trans	302	420	6.2e-10	PFAM
Pfam:Ion_trans_2	395	464	2.6e-9	PFAM
cNMP	541	659	3.21e-23	SMART
coiled coil region	729	756	N/A	INTRINSIC
low complexity region	848	859	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140695

Predicted Effect

possibly damaging
Transcript: ENSMUST00000145539
AA Change: D232G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000137675
Gene: ENSMUSG00000001901
AA Change: D232G

Domain	Start	End	E-Value	Type
Blast:PAS	13	87	3e-43	BLAST
PAC	93	135	4.06e-2	SMART
low complexity region	139	152	N/A	INTRINSIC
low complexity region	158	173	N/A	INTRINSIC
transmembrane domain	261	283	N/A	INTRINSIC
Pfam:Ion_trans	302	511	1.4e-22	PFAM
Pfam:Ion_trans_2	442	517	2e-13	PFAM
cNMP	594	712	3.21e-23	SMART
low complexity region	764	775	N/A	INTRINSIC

Meta Mutation Damage Score

0.3105

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021A07Rik	G	C	10: 21,425,593		noncoding transcript	Het
4932415D10Rik	G	T	10: 82,283,667	A4503E	probably damaging	Het
Adgrv1	C	T	13: 81,095,487	V6265I	probably benign	Het
Agbl1	G	A	7: 76,720,133	G660D	probably damaging	Het
Arap2	A	G	5: 62,654,049	Y1140H	probably damaging	Het
Atp6v1c1	T	C	15: 38,679,413		probably null	Het
C1rb	A	T	6: 124,580,313	R470W	possibly damaging	Het
Caskin2	T	C	11: 115,800,738	T1074A	probably benign	Het
Cdh19	T	A	1: 110,954,661	T34S	probably benign	Het
Csnk1a1	T	A	18: 61,575,476	Y175N	probably damaging	Het
F2	CAGAAAG	CAG	2: 91,634,957		probably benign	Het
Flt4	T	A	11: 49,627,159	V342D	possibly damaging	Het
Frmd5	A	T	2: 121,548,921	C394S	possibly damaging	Het
Gm5414	T	G	15: 101,624,038	N550T	probably benign	Het
Hcn3	C	A	3: 89,149,923	R456L	probably damaging	Het
Htt	T	C	5: 34,824,395	V893A	possibly damaging	Het
Ift46	A	G	9: 44,786,849	D203G	probably damaging	Het
Itga10	G	T	3: 96,648,164	V145L	probably benign	Het
Mbtd1	T	C	11: 93,929,671	S431P	probably damaging	Het
Mmp27	T	A	9: 7,572,158	W120R	probably damaging	Het
Mmp27	A	T	9: 7,579,000	D418V	probably damaging	Het
Myo5a	A	G	9: 75,152,020	D510G	probably damaging	Het
Myo5a	A	T	9: 75,184,389	K1179*	probably null	Het
Neto1	T	C	18: 86,398,281	S38P	probably benign	Het
Nos3	A	G	5: 24,368,918		probably benign	Het
Nuggc	C	T	14: 65,635,090	R512*	probably null	Het
Oas1e	T	A	5: 120,794,264	K105*	probably null	Het
Olfr135	A	C	17: 38,208,317	E24A	possibly damaging	Het
Olfr512	T	C	7: 108,713,812	F141S	probably damaging	Het
Omd	T	A	13: 49,589,698	S75T	possibly damaging	Het
Pbrm1	A	G	14: 31,032,530	N190S	probably benign	Het
Picalm	T	C	7: 90,170,633	F85L	probably damaging	Het
Polg	A	G	7: 79,460,300	V360A	possibly damaging	Het
Prex1	T	C	2: 166,581,921	D1017G	probably damaging	Het
Prss56	G	C	1: 87,188,111	R569P	probably damaging	Het
Rab6b	G	A	9: 103,140,384	G25R	probably damaging	Het
Rdh10	A	G	1: 16,131,385	T332A	probably benign	Het
Rheb	A	T	5: 24,807,641	M115K	probably benign	Het
Rnf149	A	T	1: 39,555,656	D321E	probably benign	Het
Rps28	C	T	17: 33,823,203		probably null	Het
Slc6a20b	A	G	9: 123,595,054	V616A	probably benign	Het
Smarcc2	A	G	10: 128,469,300	K300R	probably damaging	Het
Sparcl1	C	T	5: 104,085,763	M573I	probably damaging	Het
Srp68	C	T	11: 116,248,747	V459M	probably damaging	Het
Stxbp4	C	T	11: 90,548,975	V346I	probably benign	Het
Syne2	A	G	12: 75,952,826	D2331G	probably damaging	Het
Ttn	A	T	2: 76,734,192	Y28534N	probably damaging	Het
Usp44	A	T	10: 93,846,845	I386F	possibly damaging	Het
Vmn2r15	T	C	5: 109,288,451		probably null	Het
Vmn2r72	T	A	7: 85,737,853	L834F	probably damaging	Het
Vps13b	T	A	15: 35,923,202	I3741K	probably damaging	Het
Zdbf2	A	G	1: 63,309,073	T2204A	possibly damaging	Het
Zfp607b	T	A	7: 27,693,636		probably benign	Het

Other mutations in Kcnh6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Kcnh6	APN	11	106019019	missense	probably damaging	1.00
IGL01349:Kcnh6	APN	11	106023917	missense	possibly damaging	0.82
IGL01529:Kcnh6	APN	11	106020696	missense	probably benign	0.07
IGL01555:Kcnh6	APN	11	106017619	missense	probably damaging	0.99
IGL01596:Kcnh6	APN	11	106026746	missense	probably benign	0.02
IGL01808:Kcnh6	APN	11	106023927	splice site	probably benign
IGL02001:Kcnh6	APN	11	106027549	splice site	probably benign
IGL02131:Kcnh6	APN	11	106020175	missense	probably damaging	1.00
IGL02254:Kcnh6	APN	11	106020707	missense	probably damaging	1.00
IGL02413:Kcnh6	APN	11	106027634	missense	possibly damaging	0.77
R0089:Kcnh6	UTSW	11	106009022	missense	probably benign	0.31
R1914:Kcnh6	UTSW	11	106017444	nonsense	probably null
R1915:Kcnh6	UTSW	11	106017444	nonsense	probably null
R2265:Kcnh6	UTSW	11	106033817	missense	probably benign
R2325:Kcnh6	UTSW	11	106033835	missense	probably benign	0.00
R4449:Kcnh6	UTSW	11	106018936	missense	probably damaging	0.99
R4548:Kcnh6	UTSW	11	106009049	missense	probably damaging	1.00
R5166:Kcnh6	UTSW	11	106020319	missense	possibly damaging	0.67
R5358:Kcnh6	UTSW	11	106027591	missense	possibly damaging	0.93
R5445:Kcnh6	UTSW	11	106023859	missense	probably damaging	1.00
R5652:Kcnh6	UTSW	11	106008985	missense	probably damaging	1.00
R5708:Kcnh6	UTSW	11	106020256	missense	probably benign	0.04
R5742:Kcnh6	UTSW	11	106009142	missense	probably benign	0.32
R6035:Kcnh6	UTSW	11	106019152	critical splice donor site	probably null
R6035:Kcnh6	UTSW	11	106019152	critical splice donor site	probably null
R6150:Kcnh6	UTSW	11	106020731	missense	possibly damaging	0.83
R6827:Kcnh6	UTSW	11	106009099	missense	probably benign	0.05
R7172:Kcnh6	UTSW	11	106020274	missense	possibly damaging	0.86
R7329:Kcnh6	UTSW	11	106017377	missense	probably benign	0.29
R7359:Kcnh6	UTSW	11	106018963	missense	possibly damaging	0.46
R7542:Kcnh6	UTSW	11	106014561	missense	possibly damaging	0.68
R7571:Kcnh6	UTSW	11	106017416	missense	probably benign	0.01
R7580:Kcnh6	UTSW	11	106017548	missense	probably damaging	1.00
R7703:Kcnh6	UTSW	11	106023877	missense	probably benign
R7726:Kcnh6	UTSW	11	106017575	missense	probably benign	0.04
R7837:Kcnh6	UTSW	11	106033810	missense	probably benign	0.04
R7854:Kcnh6	UTSW	11	106017346	missense	probably damaging	1.00
R7971:Kcnh6	UTSW	11	106017527	missense	probably damaging	1.00
R8218:Kcnh6	UTSW	11	106017374	missense	possibly damaging	0.88
R8274:Kcnh6	UTSW	11	106020161	missense	probably damaging	1.00
R8351:Kcnh6	UTSW	11	106020236	missense	probably damaging	0.99
R8991:Kcnh6	UTSW	11	106019145	missense	possibly damaging	0.65
R9042:Kcnh6	UTSW	11	106017638	missense	possibly damaging	0.46
R9272:Kcnh6	UTSW	11	106034034	missense	possibly damaging	0.93
R9273:Kcnh6	UTSW	11	106034034	missense	possibly damaging	0.93
R9274:Kcnh6	UTSW	11	106034034	missense	possibly damaging	0.93
R9428:Kcnh6	UTSW	11	106008995	missense	probably damaging	1.00
X0065:Kcnh6	UTSW	11	106025795	missense	probably benign
Z1088:Kcnh6	UTSW	11	106009048	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATCAACCATGTGGCAGAG -3'
(R):5'- TATCCACGATGAGGTCCACCAC -3'

Sequencing Primer
(F):5'- GCTCTCTCCCTCTGTCCTAC -3'
(R):5'- AGGTACCACGCTGTGAGTC -3'

Posted On

2016-06-21