Incidental Mutation 'R5095:Caskin2'
ID395838
Institutional Source Beutler Lab
Gene Symbol Caskin2
Ensembl Gene ENSMUSG00000034471
Gene NameCASK-interacting protein 2
Synonyms1600028L06Rik
MMRRC Submission 042684-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.404) question?
Stock #R5095 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115799183-115813639 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115800738 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1074 (T1074A)
Ref Sequence ENSEMBL: ENSMUSP00000041328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041684] [ENSMUST00000093912] [ENSMUST00000103033] [ENSMUST00000132780]
Predicted Effect probably benign
Transcript: ENSMUST00000041684
AA Change: T1074A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041328
Gene: ENSMUSG00000034471
AA Change: T1074A

DomainStartEndE-ValueType
ANK 2 32 1.27e3 SMART
ANK 48 77 3.01e-4 SMART
ANK 81 110 3.41e-3 SMART
ANK 114 143 1.4e-4 SMART
ANK 147 176 3.26e0 SMART
ANK 188 217 3.33e-6 SMART
ANK 220 249 4.82e-3 SMART
SH3 284 346 1.13e-6 SMART
SAM 485 551 8.53e-12 SMART
SAM 554 621 1.41e-12 SMART
low complexity region 762 774 N/A INTRINSIC
Pfam:Caskin-Pro-rich 793 883 1.4e-32 PFAM
low complexity region 904 921 N/A INTRINSIC
low complexity region 925 944 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1042 1069 N/A INTRINSIC
low complexity region 1084 1090 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
Pfam:Caskin-tail 1144 1201 4.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093912
SMART Domains Protein: ENSMUSP00000091440
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
SCOP:d1eula_ 979 1282 6e-10 SMART
transmembrane domain 1310 1332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103033
SMART Domains Protein: ENSMUSP00000099322
Gene: ENSMUSG00000020747

DomainStartEndE-ValueType
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 94 113 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
low complexity region 217 226 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
low complexity region 397 407 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 920 929 N/A INTRINSIC
low complexity region 1096 1109 N/A INTRINSIC
Pfam:Cation_ATPase_C 1120 1334 5.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125658
Predicted Effect probably benign
Transcript: ENSMUST00000132780
SMART Domains Protein: ENSMUSP00000119158
Gene: ENSMUSG00000034471

DomainStartEndE-ValueType
ANK 27 56 3.01e-4 SMART
ANK 60 89 3.41e-3 SMART
ANK 93 122 1.4e-4 SMART
ANK 126 155 3.26e0 SMART
ANK 167 196 3.33e-6 SMART
ANK 199 228 4.82e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175989
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that contains six ankyrin repeats, as well as a Src homology 3 (SH3) domain and two sterile alpha motif (SAM) domains, which may be involved in protein-protein interactions. The C-terminal portion of this protein is proline-rich and contains a conserved region. A related protein interacts with calcium/calmodulin-dependent serine protein kinase (CASK). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021A07Rik G C 10: 21,425,593 noncoding transcript Het
4932415D10Rik G T 10: 82,283,667 A4503E probably damaging Het
Adgrv1 C T 13: 81,095,487 V6265I probably benign Het
Agbl1 G A 7: 76,720,133 G660D probably damaging Het
Arap2 A G 5: 62,654,049 Y1140H probably damaging Het
Atp6v1c1 T C 15: 38,679,413 probably null Het
C1rb A T 6: 124,580,313 R470W possibly damaging Het
Cdh19 T A 1: 110,954,661 T34S probably benign Het
Csnk1a1 T A 18: 61,575,476 Y175N probably damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Flt4 T A 11: 49,627,159 V342D possibly damaging Het
Frmd5 A T 2: 121,548,921 C394S possibly damaging Het
Gm5414 T G 15: 101,624,038 N550T probably benign Het
Hcn3 C A 3: 89,149,923 R456L probably damaging Het
Htt T C 5: 34,824,395 V893A possibly damaging Het
Ift46 A G 9: 44,786,849 D203G probably damaging Het
Itga10 G T 3: 96,648,164 V145L probably benign Het
Kcnh6 A G 11: 106,017,254 D232G possibly damaging Het
Mbtd1 T C 11: 93,929,671 S431P probably damaging Het
Mmp27 T A 9: 7,572,158 W120R probably damaging Het
Mmp27 A T 9: 7,579,000 D418V probably damaging Het
Myo5a A G 9: 75,152,020 D510G probably damaging Het
Myo5a A T 9: 75,184,389 K1179* probably null Het
Neto1 T C 18: 86,398,281 S38P probably benign Het
Nos3 A G 5: 24,368,918 probably benign Het
Nuggc C T 14: 65,635,090 R512* probably null Het
Oas1e T A 5: 120,794,264 K105* probably null Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr512 T C 7: 108,713,812 F141S probably damaging Het
Omd T A 13: 49,589,698 S75T possibly damaging Het
Pbrm1 A G 14: 31,032,530 N190S probably benign Het
Picalm T C 7: 90,170,633 F85L probably damaging Het
Polg A G 7: 79,460,300 V360A possibly damaging Het
Prex1 T C 2: 166,581,921 D1017G probably damaging Het
Prss56 G C 1: 87,188,111 R569P probably damaging Het
Rab6b G A 9: 103,140,384 G25R probably damaging Het
Rdh10 A G 1: 16,131,385 T332A probably benign Het
Rheb A T 5: 24,807,641 M115K probably benign Het
Rnf149 A T 1: 39,555,656 D321E probably benign Het
Rps28 C T 17: 33,823,203 probably null Het
Slc6a20b A G 9: 123,595,054 V616A probably benign Het
Smarcc2 A G 10: 128,469,300 K300R probably damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Srp68 C T 11: 116,248,747 V459M probably damaging Het
Stxbp4 C T 11: 90,548,975 V346I probably benign Het
Syne2 A G 12: 75,952,826 D2331G probably damaging Het
Ttn A T 2: 76,734,192 Y28534N probably damaging Het
Usp44 A T 10: 93,846,845 I386F possibly damaging Het
Vmn2r15 T C 5: 109,288,451 probably null Het
Vmn2r72 T A 7: 85,737,853 L834F probably damaging Het
Vps13b T A 15: 35,923,202 I3741K probably damaging Het
Zdbf2 A G 1: 63,309,073 T2204A possibly damaging Het
Zfp607b T A 7: 27,693,636 probably benign Het
Other mutations in Caskin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Caskin2 APN 11 115803599 missense probably benign 0.00
IGL01936:Caskin2 APN 11 115804717 missense probably damaging 0.99
IGL02322:Caskin2 APN 11 115804477 missense probably damaging 0.99
R0119:Caskin2 UTSW 11 115802427 unclassified probably benign
R0127:Caskin2 UTSW 11 115800994 missense probably damaging 1.00
R0565:Caskin2 UTSW 11 115801016 missense probably damaging 1.00
R0741:Caskin2 UTSW 11 115804800 missense probably damaging 1.00
R1332:Caskin2 UTSW 11 115803345 unclassified probably benign
R1474:Caskin2 UTSW 11 115803696 missense probably benign 0.05
R1720:Caskin2 UTSW 11 115802782 missense probably damaging 1.00
R1968:Caskin2 UTSW 11 115803614 missense probably benign 0.00
R2054:Caskin2 UTSW 11 115806301 unclassified probably benign
R2061:Caskin2 UTSW 11 115803630 missense probably benign
R2893:Caskin2 UTSW 11 115801277 missense probably benign 0.00
R3036:Caskin2 UTSW 11 115806356 missense probably damaging 1.00
R3123:Caskin2 UTSW 11 115804797 missense probably damaging 1.00
R3124:Caskin2 UTSW 11 115804797 missense probably damaging 1.00
R4822:Caskin2 UTSW 11 115807299 missense probably damaging 1.00
R5654:Caskin2 UTSW 11 115800079 critical splice acceptor site probably null
R5743:Caskin2 UTSW 11 115802289 missense possibly damaging 0.66
R5801:Caskin2 UTSW 11 115803473 missense probably damaging 1.00
R5808:Caskin2 UTSW 11 115801763 missense probably damaging 1.00
R6259:Caskin2 UTSW 11 115800453 missense probably damaging 1.00
R6618:Caskin2 UTSW 11 115800029 missense possibly damaging 0.89
R7142:Caskin2 UTSW 11 115806736 missense probably benign 0.29
R7192:Caskin2 UTSW 11 115801376 missense probably damaging 1.00
R7247:Caskin2 UTSW 11 115801896 missense probably benign
R7290:Caskin2 UTSW 11 115804789 missense possibly damaging 0.63
R7451:Caskin2 UTSW 11 115812155 start gained probably benign
X0063:Caskin2 UTSW 11 115806412 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAATGCCAGCTGAGTGC -3'
(R):5'- ACTGCACTGTTGGCCTTTGG -3'

Sequencing Primer
(F):5'- AGGCCACAGACACAGGCTTG -3'
(R):5'- TAGTGGGCAGTGATACCCC -3'
Posted On2016-06-21