Incidental Mutation 'R5095:Nuggc'
ID 395844
Institutional Source Beutler Lab
Gene Symbol Nuggc
Ensembl Gene ENSMUSG00000061356
Gene Name nuclear GTPase, germinal center associated
Synonyms SLIP-GC, Gm600, LOC239151
MMRRC Submission 042684-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R5095 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 65835995-65885980 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 65872539 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 512 (R512*)
Ref Sequence ENSEMBL: ENSMUSP00000118402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079469] [ENSMUST00000150897]
AlphaFold D3YWJ0
Predicted Effect probably null
Transcript: ENSMUST00000079469
AA Change: R528*
SMART Domains Protein: ENSMUSP00000078434
Gene: ENSMUSG00000061356
AA Change: R528*

DomainStartEndE-ValueType
Pfam:Dynamin_N 119 372 2.2e-15 PFAM
low complexity region 406 421 N/A INTRINSIC
Blast:AAA 434 739 4e-14 BLAST
coiled coil region 758 792 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150897
AA Change: R512*
SMART Domains Protein: ENSMUSP00000118402
Gene: ENSMUSG00000061356
AA Change: R512*

DomainStartEndE-ValueType
Pfam:Dynamin_N 103 356 6.1e-16 PFAM
low complexity region 390 405 N/A INTRINSIC
Blast:AAA 418 723 4e-14 BLAST
coiled coil region 742 776 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased somatic mutation frequency immunoglobulin and non-immunoglobulin loci in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021A07Rik G C 10: 21,301,492 (GRCm39) noncoding transcript Het
Adgrv1 C T 13: 81,243,606 (GRCm39) V6265I probably benign Het
Agbl1 G A 7: 76,369,881 (GRCm39) G660D probably damaging Het
Arap2 A G 5: 62,811,392 (GRCm39) Y1140H probably damaging Het
Atp6v1c1 T C 15: 38,679,657 (GRCm39) probably null Het
C1rb A T 6: 124,557,272 (GRCm39) R470W possibly damaging Het
Caskin2 T C 11: 115,691,564 (GRCm39) T1074A probably benign Het
Cdh19 T A 1: 110,882,391 (GRCm39) T34S probably benign Het
Csnk1a1 T A 18: 61,708,547 (GRCm39) Y175N probably damaging Het
F2 CAGAAAG CAG 2: 91,465,302 (GRCm39) probably benign Het
Flt4 T A 11: 49,517,986 (GRCm39) V342D possibly damaging Het
Frmd5 A T 2: 121,379,402 (GRCm39) C394S possibly damaging Het
Gm5414 T G 15: 101,532,473 (GRCm39) N550T probably benign Het
Hcn3 C A 3: 89,057,230 (GRCm39) R456L probably damaging Het
Htt T C 5: 34,981,739 (GRCm39) V893A possibly damaging Het
Ift46 A G 9: 44,698,146 (GRCm39) D203G probably damaging Het
Itga10 G T 3: 96,555,480 (GRCm39) V145L probably benign Het
Kcnh6 A G 11: 105,908,080 (GRCm39) D232G possibly damaging Het
Mbtd1 T C 11: 93,820,497 (GRCm39) S431P probably damaging Het
Mmp27 T A 9: 7,572,159 (GRCm39) W120R probably damaging Het
Mmp27 A T 9: 7,579,001 (GRCm39) D418V probably damaging Het
Myo5a A G 9: 75,059,302 (GRCm39) D510G probably damaging Het
Myo5a A T 9: 75,091,671 (GRCm39) K1179* probably null Het
Neto1 T C 18: 86,416,406 (GRCm39) S38P probably benign Het
Nos3 A G 5: 24,573,916 (GRCm39) probably benign Het
Oas1e T A 5: 120,932,329 (GRCm39) K105* probably null Het
Omd T A 13: 49,743,174 (GRCm39) S75T possibly damaging Het
Or10a3m T C 7: 108,313,019 (GRCm39) F141S probably damaging Het
Or2n1c A C 17: 38,519,208 (GRCm39) E24A possibly damaging Het
Pbrm1 A G 14: 30,754,487 (GRCm39) N190S probably benign Het
Picalm T C 7: 89,819,841 (GRCm39) F85L probably damaging Het
Polg A G 7: 79,110,048 (GRCm39) V360A possibly damaging Het
Prex1 T C 2: 166,423,841 (GRCm39) D1017G probably damaging Het
Prss56 G C 1: 87,115,833 (GRCm39) R569P probably damaging Het
Rab6b G A 9: 103,017,583 (GRCm39) G25R probably damaging Het
Rdh10 A G 1: 16,201,609 (GRCm39) T332A probably benign Het
Rheb A T 5: 25,012,639 (GRCm39) M115K probably benign Het
Rnf149 A T 1: 39,594,737 (GRCm39) D321E probably benign Het
Rps28 C T 17: 34,042,177 (GRCm39) probably null Het
Slc6a20b A G 9: 123,424,119 (GRCm39) V616A probably benign Het
Smarcc2 A G 10: 128,305,169 (GRCm39) K300R probably damaging Het
Sparcl1 C T 5: 104,233,629 (GRCm39) M573I probably damaging Het
Spata31h1 G T 10: 82,119,501 (GRCm39) A4503E probably damaging Het
Srp68 C T 11: 116,139,573 (GRCm39) V459M probably damaging Het
Stxbp4 C T 11: 90,439,801 (GRCm39) V346I probably benign Het
Syne2 A G 12: 75,999,600 (GRCm39) D2331G probably damaging Het
Ttn A T 2: 76,564,536 (GRCm39) Y28534N probably damaging Het
Usp44 A T 10: 93,682,707 (GRCm39) I386F possibly damaging Het
Vmn2r15 T C 5: 109,436,317 (GRCm39) probably null Het
Vmn2r72 T A 7: 85,387,061 (GRCm39) L834F probably damaging Het
Vps13b T A 15: 35,923,348 (GRCm39) I3741K probably damaging Het
Zdbf2 A G 1: 63,348,232 (GRCm39) T2204A possibly damaging Het
Zfp607b T A 7: 27,393,061 (GRCm39) probably benign Het
Other mutations in Nuggc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Nuggc APN 14 65,860,656 (GRCm39) missense probably damaging 1.00
IGL01403:Nuggc APN 14 65,860,635 (GRCm39) missense probably benign 0.01
IGL01413:Nuggc APN 14 65,876,030 (GRCm39) missense probably benign 0.23
IGL02588:Nuggc APN 14 65,855,226 (GRCm39) splice site probably benign
R0102:Nuggc UTSW 14 65,851,000 (GRCm39) missense probably null 1.00
R0102:Nuggc UTSW 14 65,851,000 (GRCm39) missense probably null 1.00
R0395:Nuggc UTSW 14 65,850,921 (GRCm39) nonsense probably null
R0827:Nuggc UTSW 14 65,846,340 (GRCm39) missense probably damaging 1.00
R1496:Nuggc UTSW 14 65,861,582 (GRCm39) missense probably damaging 0.96
R1861:Nuggc UTSW 14 65,879,450 (GRCm39) splice site probably benign
R1986:Nuggc UTSW 14 65,879,370 (GRCm39) missense probably damaging 0.98
R1995:Nuggc UTSW 14 65,848,623 (GRCm39) missense probably benign 0.02
R2283:Nuggc UTSW 14 65,876,061 (GRCm39) missense possibly damaging 0.89
R2317:Nuggc UTSW 14 65,861,591 (GRCm39) missense possibly damaging 0.81
R3799:Nuggc UTSW 14 65,857,087 (GRCm39) missense probably benign 0.00
R3980:Nuggc UTSW 14 65,856,542 (GRCm39) critical splice donor site probably null
R4303:Nuggc UTSW 14 65,848,621 (GRCm39) missense possibly damaging 0.77
R4431:Nuggc UTSW 14 65,848,659 (GRCm39) missense probably benign 0.19
R4734:Nuggc UTSW 14 65,860,679 (GRCm39) missense probably damaging 1.00
R5108:Nuggc UTSW 14 65,876,129 (GRCm39) missense probably damaging 0.99
R5360:Nuggc UTSW 14 65,876,075 (GRCm39) missense probably damaging 1.00
R5547:Nuggc UTSW 14 65,879,330 (GRCm39) missense possibly damaging 0.87
R5636:Nuggc UTSW 14 65,885,637 (GRCm39) nonsense probably null
R6494:Nuggc UTSW 14 65,885,671 (GRCm39) missense probably damaging 1.00
R6922:Nuggc UTSW 14 65,855,092 (GRCm39) missense probably damaging 1.00
R6971:Nuggc UTSW 14 65,846,305 (GRCm39) missense probably benign 0.04
R7124:Nuggc UTSW 14 65,846,251 (GRCm39) missense probably damaging 1.00
R7273:Nuggc UTSW 14 65,857,057 (GRCm39) missense probably damaging 0.99
R7282:Nuggc UTSW 14 65,855,072 (GRCm39) missense probably damaging 1.00
R7578:Nuggc UTSW 14 65,885,623 (GRCm39) missense probably damaging 1.00
R7670:Nuggc UTSW 14 65,850,975 (GRCm39) missense probably damaging 1.00
R7780:Nuggc UTSW 14 65,882,490 (GRCm39) missense probably damaging 1.00
R7871:Nuggc UTSW 14 65,860,700 (GRCm39) missense probably benign 0.01
R8250:Nuggc UTSW 14 65,879,318 (GRCm39) missense probably benign 0.10
R8329:Nuggc UTSW 14 65,878,731 (GRCm39) missense probably benign 0.01
R8334:Nuggc UTSW 14 65,882,478 (GRCm39) missense probably benign 0.04
R8463:Nuggc UTSW 14 65,851,011 (GRCm39) missense probably damaging 1.00
R8503:Nuggc UTSW 14 65,878,797 (GRCm39) critical splice donor site probably null
R8737:Nuggc UTSW 14 65,882,535 (GRCm39) missense probably benign 0.00
R8861:Nuggc UTSW 14 65,847,484 (GRCm39) critical splice donor site probably null
R8914:Nuggc UTSW 14 65,879,354 (GRCm39) missense probably benign
R9573:Nuggc UTSW 14 65,848,603 (GRCm39) missense probably benign 0.37
R9666:Nuggc UTSW 14 65,857,045 (GRCm39) missense possibly damaging 0.86
R9792:Nuggc UTSW 14 65,847,345 (GRCm39) missense probably damaging 1.00
R9793:Nuggc UTSW 14 65,847,345 (GRCm39) missense probably damaging 1.00
R9795:Nuggc UTSW 14 65,847,345 (GRCm39) missense probably damaging 1.00
RF019:Nuggc UTSW 14 65,885,713 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCTAGGAGGTCTGTGCACTG -3'
(R):5'- CTTCAAGCTCTTTCTAGAAAGTGAG -3'

Sequencing Primer
(F):5'- GCACTGAGGGTGTCTTCTAATAAG -3'
(R):5'- CTCTTTCTAGAAAGTGAGGAGGTAG -3'
Posted On 2016-06-21