Incidental Mutation 'R5095:Olfr135'
ID395850
Institutional Source Beutler Lab
Gene Symbol Olfr135
Ensembl Gene ENSMUSG00000057801
Gene Nameolfactory receptor 135
SynonymsGA_x6K02T2PSCP-2656648-2657586, MOR256-48
MMRRC Submission 042684-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R5095 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location38204335-38210915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 38208317 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 24 (E24A)
Ref Sequence ENSEMBL: ENSMUSP00000150535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076245] [ENSMUST00000213217]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076245
AA Change: E24A

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000075595
Gene: ENSMUSG00000057801
AA Change: E24A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.6e-50 PFAM
Pfam:7tm_1 41 290 9.2e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213217
AA Change: E24A

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.0988 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021A07Rik G C 10: 21,425,593 noncoding transcript Het
4932415D10Rik G T 10: 82,283,667 A4503E probably damaging Het
Adgrv1 C T 13: 81,095,487 V6265I probably benign Het
Agbl1 G A 7: 76,720,133 G660D probably damaging Het
Arap2 A G 5: 62,654,049 Y1140H probably damaging Het
Atp6v1c1 T C 15: 38,679,413 probably null Het
C1rb A T 6: 124,580,313 R470W possibly damaging Het
Caskin2 T C 11: 115,800,738 T1074A probably benign Het
Cdh19 T A 1: 110,954,661 T34S probably benign Het
Csnk1a1 T A 18: 61,575,476 Y175N probably damaging Het
F2 CAGAAAG CAG 2: 91,634,957 probably benign Het
Flt4 T A 11: 49,627,159 V342D possibly damaging Het
Frmd5 A T 2: 121,548,921 C394S possibly damaging Het
Gm5414 T G 15: 101,624,038 N550T probably benign Het
Hcn3 C A 3: 89,149,923 R456L probably damaging Het
Htt T C 5: 34,824,395 V893A possibly damaging Het
Ift46 A G 9: 44,786,849 D203G probably damaging Het
Itga10 G T 3: 96,648,164 V145L probably benign Het
Kcnh6 A G 11: 106,017,254 D232G possibly damaging Het
Mbtd1 T C 11: 93,929,671 S431P probably damaging Het
Mmp27 T A 9: 7,572,158 W120R probably damaging Het
Mmp27 A T 9: 7,579,000 D418V probably damaging Het
Myo5a A G 9: 75,152,020 D510G probably damaging Het
Myo5a A T 9: 75,184,389 K1179* probably null Het
Neto1 T C 18: 86,398,281 S38P probably benign Het
Nos3 A G 5: 24,368,918 probably benign Het
Nuggc C T 14: 65,635,090 R512* probably null Het
Oas1e T A 5: 120,794,264 K105* probably null Het
Olfr512 T C 7: 108,713,812 F141S probably damaging Het
Omd T A 13: 49,589,698 S75T possibly damaging Het
Pbrm1 A G 14: 31,032,530 N190S probably benign Het
Picalm T C 7: 90,170,633 F85L probably damaging Het
Polg A G 7: 79,460,300 V360A possibly damaging Het
Prex1 T C 2: 166,581,921 D1017G probably damaging Het
Prss56 G C 1: 87,188,111 R569P probably damaging Het
Rab6b G A 9: 103,140,384 G25R probably damaging Het
Rdh10 A G 1: 16,131,385 T332A probably benign Het
Rheb A T 5: 24,807,641 M115K probably benign Het
Rnf149 A T 1: 39,555,656 D321E probably benign Het
Rps28 C T 17: 33,823,203 probably null Het
Slc6a20b A G 9: 123,595,054 V616A probably benign Het
Smarcc2 A G 10: 128,469,300 K300R probably damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Srp68 C T 11: 116,248,747 V459M probably damaging Het
Stxbp4 C T 11: 90,548,975 V346I probably benign Het
Syne2 A G 12: 75,952,826 D2331G probably damaging Het
Ttn A T 2: 76,734,192 Y28534N probably damaging Het
Usp44 A T 10: 93,846,845 I386F possibly damaging Het
Vmn2r15 T C 5: 109,288,451 probably null Het
Vmn2r72 T A 7: 85,737,853 L834F probably damaging Het
Vps13b T A 15: 35,923,202 I3741K probably damaging Het
Zdbf2 A G 1: 63,309,073 T2204A possibly damaging Het
Zfp607b T A 7: 27,693,636 probably benign Het
Other mutations in Olfr135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Olfr135 APN 17 38208982 missense probably damaging 0.99
IGL01316:Olfr135 APN 17 38208497 missense probably damaging 0.98
IGL01666:Olfr135 APN 17 38208889 missense probably benign 0.11
IGL02096:Olfr135 APN 17 38209183 makesense probably null
R0255:Olfr135 UTSW 17 38208395 missense probably benign
R0630:Olfr135 UTSW 17 38208413 missense probably damaging 0.97
R1185:Olfr135 UTSW 17 38209183 makesense probably null
R1185:Olfr135 UTSW 17 38209183 makesense probably null
R1185:Olfr135 UTSW 17 38209183 makesense probably null
R1279:Olfr135 UTSW 17 38208787 missense probably benign 0.01
R1878:Olfr135 UTSW 17 38208374 missense probably benign 0.03
R1969:Olfr135 UTSW 17 38208464 missense probably damaging 1.00
R2374:Olfr135 UTSW 17 38209067 missense probably damaging 0.97
R3708:Olfr135 UTSW 17 38208283 missense probably benign 0.01
R5025:Olfr135 UTSW 17 38208443 missense probably damaging 1.00
R5093:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5103:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5104:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5105:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5149:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5150:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5344:Olfr135 UTSW 17 38209104 missense probably damaging 1.00
R6608:Olfr135 UTSW 17 38208479 missense probably damaging 1.00
R7300:Olfr135 UTSW 17 38208697 missense possibly damaging 0.76
R7324:Olfr135 UTSW 17 38208716 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAATGCCAACCCTGGATTC -3'
(R):5'- CACACCTCAAGTAGCTGATGGTC -3'

Sequencing Primer
(F):5'- GAATGCCAACCCTGGATTCTATAG -3'
(R):5'- TCTTTGTAGAGCCCCAAAGG -3'
Posted On2016-06-21