Incidental Mutation 'R5132:Gpr25'
ID 395853
Institutional Source Beutler Lab
Gene Symbol Gpr25
Ensembl Gene ENSMUSG00000052759
Gene Name G protein-coupled receptor 25
Synonyms LOC383563
MMRRC Submission 042720-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5132 (G1)
Quality Score 97
Status Not validated
Chromosome 1
Chromosomal Location 136259797-136260873 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 136260365 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 170 (A170E)
Ref Sequence ENSEMBL: ENSMUSP00000083583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086395]
AlphaFold P0C5I1
Predicted Effect probably damaging
Transcript: ENSMUST00000086395
AA Change: A170E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000083583
Gene: ENSMUSG00000052759
AA Change: A170E

DomainStartEndE-ValueType
Pfam:7tm_1 56 304 1.1e-40 PFAM
low complexity region 328 342 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193939
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is intronless and encodes a member of the G-protein coupled receptor 1 family. G-protein coupled receptors are membrane proteins which activate signaling cascades as a response to extracellular stress. This gene has been linked to arterial stiffness. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A G 4: 41,517,178 probably benign Het
Abl2 A T 1: 156,641,832 K785* probably null Het
Acad11 A T 9: 104,126,592 I628L probably benign Het
Ago1 T C 4: 126,461,723 I98V probably benign Het
Bach2 A G 4: 32,563,396 probably benign Het
Calr3 C T 8: 72,431,368 probably null Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdc42ep3 C T 17: 79,335,374 R39H probably damaging Het
Cyp2j5 T C 4: 96,629,496 Y493C probably damaging Het
Ddx19b A T 8: 111,022,408 D66E probably benign Het
Drosha A G 15: 12,837,291 D287G unknown Het
Gm8888 A G 15: 96,767,011 noncoding transcript Het
Gria1 A G 11: 57,289,399 Y656C probably damaging Het
Grik5 C T 7: 25,065,204 V145I probably benign Het
Htt T C 5: 34,905,679 V2885A possibly damaging Het
Larp6 A G 9: 60,737,210 E211G probably damaging Het
Magi1 C A 6: 93,683,091 probably null Het
Mtbp A G 15: 55,558,569 S63G possibly damaging Het
Ndor1 A T 2: 25,247,769 S513T probably benign Het
Nsd3 A G 8: 25,678,839 D670G possibly damaging Het
Olfr1118 A T 2: 87,308,938 M50L probably damaging Het
Olfr1299 T A 2: 111,664,999 Y258N probably damaging Het
Olfr513 T C 7: 108,755,270 V138A probably damaging Het
Pcdh7 T C 5: 57,728,121 V1061A probably benign Het
Pdia4 A G 6: 47,796,735 I560T probably benign Het
Pomt2 A G 12: 87,110,347 F733L probably damaging Het
Pprc1 T C 19: 46,072,682 probably benign Het
Prkca T C 11: 108,192,117 probably benign Het
Pspc1 A T 14: 56,723,250 S473T probably benign Het
Rgs12 A G 5: 34,989,812 probably benign Het
Scn3a C T 2: 65,468,204 V1384I probably benign Het
Serpinb6a C T 13: 33,918,322 D307N probably benign Het
Smap2 T C 4: 120,973,173 E255G possibly damaging Het
St7 A T 6: 17,854,957 I298F probably damaging Het
Tgm7 A G 2: 121,104,219 F93L probably damaging Het
Timm23 A T 14: 32,193,945 D56E probably damaging Het
Tmem170 A T 8: 111,869,725 M56K probably benign Het
Other mutations in Gpr25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03028:Gpr25 APN 1 136260812 missense probably benign 0.00
R1728:Gpr25 UTSW 1 136260710 missense probably benign
R1729:Gpr25 UTSW 1 136260710 missense probably benign
R1732:Gpr25 UTSW 1 136260128 missense probably benign 0.01
R1739:Gpr25 UTSW 1 136260710 missense probably benign
R1762:Gpr25 UTSW 1 136260710 missense probably benign
R1783:Gpr25 UTSW 1 136260710 missense probably benign
R1785:Gpr25 UTSW 1 136260710 missense probably benign
R1907:Gpr25 UTSW 1 136260800 missense probably benign 0.00
R2877:Gpr25 UTSW 1 136260815 missense possibly damaging 0.86
R3081:Gpr25 UTSW 1 136259885 missense possibly damaging 0.68
R7133:Gpr25 UTSW 1 136260821 missense probably damaging 1.00
R8163:Gpr25 UTSW 1 136259858 missense probably damaging 1.00
R8248:Gpr25 UTSW 1 136260677 missense probably benign 0.03
R9051:Gpr25 UTSW 1 136260288 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCCACGGTGAAGATGATGC -3'
(R):5'- GTGCAAAGTCAGCAGCTTCG -3'

Sequencing Primer
(F):5'- ATGCGCAGGGAGTTGCTC -3'
(R):5'- ATGAGCGTGGACCGCTACCT -3'
Posted On 2016-06-21