Incidental Mutation 'R5132:Abl2'
ID 395854
Institutional Source Beutler Lab
Gene Symbol Abl2
Ensembl Gene ENSMUSG00000026596
Gene Name ABL proto-oncogene 2, non-receptor tyrosine kinase
Synonyms Abll, Arg
MMRRC Submission 042720-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.565) question?
Stock # R5132 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 156386356-156477138 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 156469402 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 785 (K785*)
Ref Sequence ENSEMBL: ENSMUSP00000126181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027888] [ENSMUST00000166172]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000027888
AA Change: K889*
SMART Domains Protein: ENSMUSP00000027888
Gene: ENSMUSG00000026596
AA Change: K889*

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
SH3 110 166 9.83e-16 SMART
SH2 171 254 1.34e-33 SMART
TyrKc 288 539 2.53e-148 SMART
low complexity region 561 577 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 734 752 N/A INTRINSIC
low complexity region 877 891 N/A INTRINSIC
low complexity region 974 991 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
FABD 1061 1182 5.24e-65 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166172
AA Change: K785*
SMART Domains Protein: ENSMUSP00000126181
Gene: ENSMUSG00000026596
AA Change: K785*

DomainStartEndE-ValueType
low complexity region 20 40 N/A INTRINSIC
SH3 110 166 9.83e-16 SMART
SH2 171 254 1.34e-33 SMART
TyrKc 288 539 2.53e-148 SMART
low complexity region 561 577 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 773 787 N/A INTRINSIC
low complexity region 870 887 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
FABD 957 1078 5.24e-65 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Abelson family of nonreceptor tyrosine protein kinases. The protein is highly similar to the c-abl oncogene 1 protein, including the tyrosine kinase, SH2 and SH3 domains, and it plays a role in cytoskeletal rearrangements through its C-terminal F-actin- and microtubule-binding sequences. This gene is expressed in both normal and tumor cells, and is involved in translocation with the ets variant 6 gene in leukemia. Multiple alternatively spliced transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display multiple behavioral abnormalities indicating neuronal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 A T 9: 104,003,791 (GRCm39) I628L probably benign Het
Ago1 T C 4: 126,355,516 (GRCm39) I98V probably benign Het
Bach2 A G 4: 32,563,396 (GRCm39) probably benign Het
Calr3 C T 8: 73,185,212 (GRCm39) probably null Het
Cdc23 C A 18: 34,784,742 (GRCm39) V7L unknown Het
Cdc42ep3 C T 17: 79,642,803 (GRCm39) R39H probably damaging Het
Cyp2j5 T C 4: 96,517,733 (GRCm39) Y493C probably damaging Het
Ddx19b A T 8: 111,749,040 (GRCm39) D66E probably benign Het
Drosha A G 15: 12,837,377 (GRCm39) D287G unknown Het
Gm8888 A G 15: 96,664,892 (GRCm39) noncoding transcript Het
Gpr25 G T 1: 136,188,103 (GRCm39) A170E probably damaging Het
Gria1 A G 11: 57,180,225 (GRCm39) Y656C probably damaging Het
Grik5 C T 7: 24,764,629 (GRCm39) V145I probably benign Het
Htt T C 5: 35,063,023 (GRCm39) V2885A possibly damaging Het
Larp6 A G 9: 60,644,493 (GRCm39) E211G probably damaging Het
Magi1 C A 6: 93,660,072 (GRCm39) probably null Het
Mtbp A G 15: 55,421,965 (GRCm39) S63G possibly damaging Het
Ndor1 A T 2: 25,137,781 (GRCm39) S513T probably benign Het
Nsd3 A G 8: 26,168,855 (GRCm39) D670G possibly damaging Het
Or10ag56 A T 2: 87,139,282 (GRCm39) M50L probably damaging Het
Or4k49 T A 2: 111,495,344 (GRCm39) Y258N probably damaging Het
Or5e1 T C 7: 108,354,477 (GRCm39) V138A probably damaging Het
Pcdh7 T C 5: 57,885,463 (GRCm39) V1061A probably benign Het
Pdia4 A G 6: 47,773,669 (GRCm39) I560T probably benign Het
Pomt2 A G 12: 87,157,121 (GRCm39) F733L probably damaging Het
Pprc1 T C 19: 46,061,121 (GRCm39) probably benign Het
Prkca T C 11: 108,082,943 (GRCm39) probably benign Het
Pspc1 A T 14: 56,960,707 (GRCm39) S473T probably benign Het
Rgs12 A G 5: 35,147,156 (GRCm39) probably benign Het
Scn3a C T 2: 65,298,548 (GRCm39) V1384I probably benign Het
Serpinb6a C T 13: 34,102,305 (GRCm39) D307N probably benign Het
Smap2 T C 4: 120,830,370 (GRCm39) E255G possibly damaging Het
Spmip6 A G 4: 41,517,178 (GRCm39) probably benign Het
St7 A T 6: 17,854,956 (GRCm39) I298F probably damaging Het
Tgm7 A G 2: 120,934,700 (GRCm39) F93L probably damaging Het
Timm23 A T 14: 31,915,902 (GRCm39) D56E probably damaging Het
Tmem170 A T 8: 112,596,357 (GRCm39) M56K probably benign Het
Other mutations in Abl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Abl2 APN 1 156,462,754 (GRCm39) missense probably damaging 1.00
IGL01679:Abl2 APN 1 156,470,035 (GRCm39) missense probably benign 0.01
IGL02289:Abl2 APN 1 156,457,424 (GRCm39) missense probably damaging 1.00
PIT4495001:Abl2 UTSW 1 156,460,755 (GRCm39) missense probably damaging 1.00
R0907:Abl2 UTSW 1 156,457,429 (GRCm39) missense probably damaging 1.00
R1232:Abl2 UTSW 1 156,469,300 (GRCm39) missense probably damaging 1.00
R2069:Abl2 UTSW 1 156,448,397 (GRCm39) splice site probably null
R4224:Abl2 UTSW 1 156,461,417 (GRCm39) missense probably damaging 0.98
R4305:Abl2 UTSW 1 156,469,133 (GRCm39) missense probably damaging 0.99
R4411:Abl2 UTSW 1 156,457,652 (GRCm39) missense possibly damaging 0.86
R4490:Abl2 UTSW 1 156,461,349 (GRCm39) missense probably damaging 1.00
R5383:Abl2 UTSW 1 156,469,802 (GRCm39) missense possibly damaging 0.89
R5428:Abl2 UTSW 1 156,469,681 (GRCm39) missense probably damaging 1.00
R5436:Abl2 UTSW 1 156,457,450 (GRCm39) missense probably damaging 1.00
R5760:Abl2 UTSW 1 156,469,427 (GRCm39) missense probably benign 0.06
R6051:Abl2 UTSW 1 156,469,655 (GRCm39) missense probably damaging 1.00
R6955:Abl2 UTSW 1 156,450,219 (GRCm39) missense probably damaging 1.00
R7002:Abl2 UTSW 1 156,386,703 (GRCm39) missense probably damaging 1.00
R7038:Abl2 UTSW 1 156,468,979 (GRCm39) missense possibly damaging 0.95
R7172:Abl2 UTSW 1 156,450,157 (GRCm39) missense probably damaging 1.00
R7268:Abl2 UTSW 1 156,461,509 (GRCm39) critical splice donor site probably null
R7282:Abl2 UTSW 1 156,457,630 (GRCm39) missense probably damaging 1.00
R7303:Abl2 UTSW 1 156,468,820 (GRCm39) missense probably benign 0.00
R7372:Abl2 UTSW 1 156,450,189 (GRCm39) missense probably damaging 1.00
R7375:Abl2 UTSW 1 156,450,184 (GRCm39) missense probably damaging 1.00
R7443:Abl2 UTSW 1 156,452,951 (GRCm39) missense probably damaging 1.00
R7468:Abl2 UTSW 1 156,450,104 (GRCm39) missense possibly damaging 0.68
R7614:Abl2 UTSW 1 156,464,429 (GRCm39) missense possibly damaging 0.71
R7644:Abl2 UTSW 1 156,443,563 (GRCm39) missense probably benign 0.08
R7783:Abl2 UTSW 1 156,386,641 (GRCm39) missense probably benign
R8158:Abl2 UTSW 1 156,469,639 (GRCm39) missense probably benign 0.00
R8675:Abl2 UTSW 1 156,452,909 (GRCm39) missense probably damaging 1.00
R8930:Abl2 UTSW 1 156,461,402 (GRCm39) missense probably damaging 0.98
R8932:Abl2 UTSW 1 156,461,402 (GRCm39) missense probably damaging 0.98
R9217:Abl2 UTSW 1 156,452,902 (GRCm39) missense probably damaging 1.00
R9262:Abl2 UTSW 1 156,469,820 (GRCm39) missense possibly damaging 0.93
R9290:Abl2 UTSW 1 156,457,538 (GRCm39) missense probably damaging 1.00
R9571:Abl2 UTSW 1 156,469,084 (GRCm39) missense probably damaging 0.99
X0067:Abl2 UTSW 1 156,459,003 (GRCm39) splice site probably null
Z1177:Abl2 UTSW 1 156,469,123 (GRCm39) frame shift probably null
Z1177:Abl2 UTSW 1 156,468,676 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTGGAAAGGACAGTGTC -3'
(R):5'- CATCAGCTGGAGTGTGTTTCAG -3'

Sequencing Primer
(F):5'- TGGACAGGGCTAATGACATGCTTC -3'
(R):5'- TGTGTTTCAGAGTGGGAGAGATAAG -3'
Posted On 2016-06-21