Incidental Mutation 'R5132:Ndor1'
ID 395855
Institutional Source Beutler Lab
Gene Symbol Ndor1
Ensembl Gene ENSMUSG00000006471
Gene Name NADPH dependent diflavin oxidoreductase 1
Synonyms 4930447P04Rik, NR1
MMRRC Submission 042720-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.944) question?
Stock # R5132 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 25134825-25145458 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25137781 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 513 (S513T)
Ref Sequence ENSEMBL: ENSMUSP00000097903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060818] [ENSMUST00000100329] [ENSMUST00000114349] [ENSMUST00000114355] [ENSMUST00000228627] [ENSMUST00000148589] [ENSMUST00000132128] [ENSMUST00000147866] [ENSMUST00000154498] [ENSMUST00000228052]
AlphaFold A2AI05
Predicted Effect probably benign
Transcript: ENSMUST00000060818
SMART Domains Protein: ENSMUSP00000057742
Gene: ENSMUSG00000044628

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
RING 147 193 1.11e-2 SMART
low complexity region 227 238 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100329
AA Change: S513T

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097903
Gene: ENSMUSG00000006471
AA Change: S513T

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 8 124 2.3e-23 PFAM
Pfam:FAD_binding_1 134 354 8e-50 PFAM
Pfam:NAD_binding_1 389 495 2.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114349
AA Change: S580T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109989
Gene: ENSMUSG00000006471
AA Change: S580T

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 8 145 2.3e-32 PFAM
Pfam:FAD_binding_1 201 421 2e-48 PFAM
Pfam:NAD_binding_1 456 561 1.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114355
SMART Domains Protein: ENSMUSP00000109995
Gene: ENSMUSG00000044628

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
RING 147 193 1.11e-2 SMART
low complexity region 227 238 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137355
Predicted Effect probably benign
Transcript: ENSMUST00000228627
Predicted Effect probably benign
Transcript: ENSMUST00000141808
SMART Domains Protein: ENSMUSP00000123247
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
Pfam:Flavodoxin_1 7 120 8.1e-25 PFAM
Pfam:FAD_binding_1 167 225 9.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148589
SMART Domains Protein: ENSMUSP00000123958
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
PDB:4H2D|B 1 49 7e-10 PDB
SCOP:d1f4pa_ 4 45 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132128
SMART Domains Protein: ENSMUSP00000125018
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
PDB:4H2D|B 1 48 2e-9 PDB
SCOP:d1f4pa_ 4 57 4e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147866
SMART Domains Protein: ENSMUSP00000125259
Gene: ENSMUSG00000006471

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Pfam:Flavodoxin_1 93 196 4.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154498
Predicted Effect probably benign
Transcript: ENSMUST00000228052
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an NADPH-dependent diflavin reductase that contains both flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD) binding domains. The encoded protein catalyzes the transfer of electrons from NADPH through FAD and FMN cofactors to potential redox partners. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 A T 1: 156,469,402 (GRCm39) K785* probably null Het
Acad11 A T 9: 104,003,791 (GRCm39) I628L probably benign Het
Ago1 T C 4: 126,355,516 (GRCm39) I98V probably benign Het
Bach2 A G 4: 32,563,396 (GRCm39) probably benign Het
Calr3 C T 8: 73,185,212 (GRCm39) probably null Het
Cdc23 C A 18: 34,784,742 (GRCm39) V7L unknown Het
Cdc42ep3 C T 17: 79,642,803 (GRCm39) R39H probably damaging Het
Cyp2j5 T C 4: 96,517,733 (GRCm39) Y493C probably damaging Het
Ddx19b A T 8: 111,749,040 (GRCm39) D66E probably benign Het
Drosha A G 15: 12,837,377 (GRCm39) D287G unknown Het
Gm8888 A G 15: 96,664,892 (GRCm39) noncoding transcript Het
Gpr25 G T 1: 136,188,103 (GRCm39) A170E probably damaging Het
Gria1 A G 11: 57,180,225 (GRCm39) Y656C probably damaging Het
Grik5 C T 7: 24,764,629 (GRCm39) V145I probably benign Het
Htt T C 5: 35,063,023 (GRCm39) V2885A possibly damaging Het
Larp6 A G 9: 60,644,493 (GRCm39) E211G probably damaging Het
Magi1 C A 6: 93,660,072 (GRCm39) probably null Het
Mtbp A G 15: 55,421,965 (GRCm39) S63G possibly damaging Het
Nsd3 A G 8: 26,168,855 (GRCm39) D670G possibly damaging Het
Or10ag56 A T 2: 87,139,282 (GRCm39) M50L probably damaging Het
Or4k49 T A 2: 111,495,344 (GRCm39) Y258N probably damaging Het
Or5e1 T C 7: 108,354,477 (GRCm39) V138A probably damaging Het
Pcdh7 T C 5: 57,885,463 (GRCm39) V1061A probably benign Het
Pdia4 A G 6: 47,773,669 (GRCm39) I560T probably benign Het
Pomt2 A G 12: 87,157,121 (GRCm39) F733L probably damaging Het
Pprc1 T C 19: 46,061,121 (GRCm39) probably benign Het
Prkca T C 11: 108,082,943 (GRCm39) probably benign Het
Pspc1 A T 14: 56,960,707 (GRCm39) S473T probably benign Het
Rgs12 A G 5: 35,147,156 (GRCm39) probably benign Het
Scn3a C T 2: 65,298,548 (GRCm39) V1384I probably benign Het
Serpinb6a C T 13: 34,102,305 (GRCm39) D307N probably benign Het
Smap2 T C 4: 120,830,370 (GRCm39) E255G possibly damaging Het
Spmip6 A G 4: 41,517,178 (GRCm39) probably benign Het
St7 A T 6: 17,854,956 (GRCm39) I298F probably damaging Het
Tgm7 A G 2: 120,934,700 (GRCm39) F93L probably damaging Het
Timm23 A T 14: 31,915,902 (GRCm39) D56E probably damaging Het
Tmem170 A T 8: 112,596,357 (GRCm39) M56K probably benign Het
Other mutations in Ndor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Ndor1 APN 2 25,140,151 (GRCm39) missense probably benign 0.05
IGL02174:Ndor1 APN 2 25,139,206 (GRCm39) missense possibly damaging 0.49
IGL02366:Ndor1 APN 2 25,137,993 (GRCm39) missense possibly damaging 0.94
IGL02407:Ndor1 APN 2 25,139,281 (GRCm39) missense probably benign 0.39
IGL02630:Ndor1 APN 2 25,145,299 (GRCm39) missense probably damaging 1.00
R0139:Ndor1 UTSW 2 25,138,366 (GRCm39) missense possibly damaging 0.90
R0194:Ndor1 UTSW 2 25,138,718 (GRCm39) splice site probably null
R0926:Ndor1 UTSW 2 25,138,360 (GRCm39) missense probably benign 0.08
R1530:Ndor1 UTSW 2 25,138,921 (GRCm39) missense probably benign 0.02
R1533:Ndor1 UTSW 2 25,139,279 (GRCm39) missense probably damaging 0.98
R1837:Ndor1 UTSW 2 25,138,408 (GRCm39) missense probably damaging 1.00
R1954:Ndor1 UTSW 2 25,145,305 (GRCm39) missense possibly damaging 0.86
R1981:Ndor1 UTSW 2 25,145,236 (GRCm39) missense probably damaging 0.97
R2090:Ndor1 UTSW 2 25,139,230 (GRCm39) missense probably damaging 1.00
R2188:Ndor1 UTSW 2 25,141,765 (GRCm39) splice site probably null
R3433:Ndor1 UTSW 2 25,137,823 (GRCm39) missense possibly damaging 0.91
R3620:Ndor1 UTSW 2 25,138,047 (GRCm39) missense probably damaging 1.00
R4013:Ndor1 UTSW 2 25,140,162 (GRCm39) missense probably damaging 0.98
R4411:Ndor1 UTSW 2 25,138,492 (GRCm39) missense probably benign 0.08
R4457:Ndor1 UTSW 2 25,138,128 (GRCm39) splice site probably null
R4942:Ndor1 UTSW 2 25,138,133 (GRCm39) critical splice donor site probably null
R6476:Ndor1 UTSW 2 25,138,154 (GRCm39) missense possibly damaging 0.95
R6702:Ndor1 UTSW 2 25,139,902 (GRCm39) missense possibly damaging 0.95
R6703:Ndor1 UTSW 2 25,139,902 (GRCm39) missense possibly damaging 0.95
R8016:Ndor1 UTSW 2 25,139,329 (GRCm39) missense probably benign 0.00
R8156:Ndor1 UTSW 2 25,138,746 (GRCm39) missense probably benign 0.10
R9176:Ndor1 UTSW 2 25,138,241 (GRCm39) missense probably damaging 0.98
R9396:Ndor1 UTSW 2 25,138,921 (GRCm39) missense probably benign 0.02
R9462:Ndor1 UTSW 2 25,144,875 (GRCm39) critical splice donor site probably null
R9615:Ndor1 UTSW 2 25,138,434 (GRCm39) missense probably benign
X0018:Ndor1 UTSW 2 25,137,856 (GRCm39) missense probably benign 0.03
X0019:Ndor1 UTSW 2 25,138,193 (GRCm39) missense probably damaging 1.00
Z1177:Ndor1 UTSW 2 25,137,801 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCGAAACTGTGGGTCTAC -3'
(R):5'- CAAGGTGCCTACTTCTACCTAGC -3'

Sequencing Primer
(F):5'- GAGTGTGAGCTAGCAAGT -3'
(R):5'- CTACTTCTACCTAGCAGGGTGAG -3'
Posted On 2016-06-21