Incidental Mutation 'R5132:Spmip6'
ID 395860
Institutional Source Beutler Lab
Gene Symbol Spmip6
Ensembl Gene ENSMUSG00000028441
Gene Name sperm microtubule inner protein 6
Synonyms 1110017D15Rik, Smrp1, Cbe1
MMRRC Submission 042720-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5132 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 41505009-41517333 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 41517178 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030152] [ENSMUST00000095126] [ENSMUST00000108049] [ENSMUST00000108050] [ENSMUST00000108052]
AlphaFold Q2MH31
Predicted Effect probably benign
Transcript: ENSMUST00000030152
SMART Domains Protein: ENSMUSP00000030152
Gene: ENSMUSG00000028441

DomainStartEndE-ValueType
Pfam:SMRP1 1 260 3.3e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095126
SMART Domains Protein: ENSMUSP00000092744
Gene: ENSMUSG00000028441

DomainStartEndE-ValueType
Pfam:SMRP1 1 202 6.5e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108049
SMART Domains Protein: ENSMUSP00000103684
Gene: ENSMUSG00000028439

DomainStartEndE-ValueType
Pfam:FAM219A 26 157 2.7e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108050
SMART Domains Protein: ENSMUSP00000103685
Gene: ENSMUSG00000028439

DomainStartEndE-ValueType
Pfam:FAM219A 26 156 8.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108052
SMART Domains Protein: ENSMUSP00000103687
Gene: ENSMUSG00000028439

DomainStartEndE-ValueType
Pfam:FAM219A 37 168 1.6e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151164
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear- or perinuclear-localized protein with no predicted domains or similarity to other known proteins. Expression of this gene is induced during the differentiation of bronchial epithelial cells, and the encoded protein may play a role in ciliogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 A T 1: 156,641,832 (GRCm38) K785* probably null Het
Acad11 A T 9: 104,126,592 (GRCm38) I628L probably benign Het
Ago1 T C 4: 126,461,723 (GRCm38) I98V probably benign Het
Bach2 A G 4: 32,563,396 (GRCm38) probably benign Het
Calr3 C T 8: 72,431,368 (GRCm38) probably null Het
Cdc23 C A 18: 34,651,689 (GRCm38) V7L unknown Het
Cdc42ep3 C T 17: 79,335,374 (GRCm38) R39H probably damaging Het
Cyp2j5 T C 4: 96,629,496 (GRCm38) Y493C probably damaging Het
Ddx19b A T 8: 111,022,408 (GRCm38) D66E probably benign Het
Drosha A G 15: 12,837,291 (GRCm38) D287G unknown Het
Gm8888 A G 15: 96,767,011 (GRCm38) noncoding transcript Het
Gpr25 G T 1: 136,260,365 (GRCm38) A170E probably damaging Het
Gria1 A G 11: 57,289,399 (GRCm38) Y656C probably damaging Het
Grik5 C T 7: 25,065,204 (GRCm38) V145I probably benign Het
Htt T C 5: 34,905,679 (GRCm38) V2885A possibly damaging Het
Larp6 A G 9: 60,737,210 (GRCm38) E211G probably damaging Het
Magi1 C A 6: 93,683,091 (GRCm38) probably null Het
Mtbp A G 15: 55,558,569 (GRCm38) S63G possibly damaging Het
Ndor1 A T 2: 25,247,769 (GRCm38) S513T probably benign Het
Nsd3 A G 8: 25,678,839 (GRCm38) D670G possibly damaging Het
Or10ag56 A T 2: 87,308,938 (GRCm38) M50L probably damaging Het
Or4k49 T A 2: 111,664,999 (GRCm38) Y258N probably damaging Het
Or5e1 T C 7: 108,755,270 (GRCm38) V138A probably damaging Het
Pcdh7 T C 5: 57,728,121 (GRCm38) V1061A probably benign Het
Pdia4 A G 6: 47,796,735 (GRCm38) I560T probably benign Het
Pomt2 A G 12: 87,110,347 (GRCm38) F733L probably damaging Het
Pprc1 T C 19: 46,072,682 (GRCm38) probably benign Het
Prkca T C 11: 108,192,117 (GRCm38) probably benign Het
Pspc1 A T 14: 56,723,250 (GRCm38) S473T probably benign Het
Rgs12 A G 5: 34,989,812 (GRCm38) probably benign Het
Scn3a C T 2: 65,468,204 (GRCm38) V1384I probably benign Het
Serpinb6a C T 13: 33,918,322 (GRCm38) D307N probably benign Het
Smap2 T C 4: 120,973,173 (GRCm38) E255G possibly damaging Het
St7 A T 6: 17,854,957 (GRCm38) I298F probably damaging Het
Tgm7 A G 2: 121,104,219 (GRCm38) F93L probably damaging Het
Timm23 A T 14: 32,193,945 (GRCm38) D56E probably damaging Het
Tmem170 A T 8: 111,869,725 (GRCm38) M56K probably benign Het
Other mutations in Spmip6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Spmip6 APN 4 41,507,178 (GRCm38) missense probably damaging 1.00
IGL01062:Spmip6 APN 4 41,511,433 (GRCm38) missense probably damaging 1.00
IGL02645:Spmip6 APN 4 41,517,080 (GRCm38) missense probably damaging 1.00
IGL03124:Spmip6 APN 4 41,507,287 (GRCm38) missense possibly damaging 0.87
R0284:Spmip6 UTSW 4 41,507,538 (GRCm38) missense probably damaging 1.00
R1760:Spmip6 UTSW 4 41,507,330 (GRCm38) critical splice acceptor site probably null
R1761:Spmip6 UTSW 4 41,507,223 (GRCm38) missense probably damaging 1.00
R2073:Spmip6 UTSW 4 41,507,519 (GRCm38) critical splice donor site probably null
R2180:Spmip6 UTSW 4 41,507,170 (GRCm38) missense probably benign 0.00
R4414:Spmip6 UTSW 4 41,505,574 (GRCm38) missense possibly damaging 0.71
R4415:Spmip6 UTSW 4 41,505,574 (GRCm38) missense possibly damaging 0.71
R4416:Spmip6 UTSW 4 41,505,574 (GRCm38) missense possibly damaging 0.71
R4417:Spmip6 UTSW 4 41,505,574 (GRCm38) missense possibly damaging 0.71
R4516:Spmip6 UTSW 4 41,517,200 (GRCm38) unclassified probably benign
R6132:Spmip6 UTSW 4 41,517,160 (GRCm38) start codon destroyed probably null 0.98
R6413:Spmip6 UTSW 4 41,505,135 (GRCm38) missense possibly damaging 0.86
R8519:Spmip6 UTSW 4 41,505,071 (GRCm38) missense possibly damaging 0.93
R9493:Spmip6 UTSW 4 41,508,614 (GRCm38) missense
R9594:Spmip6 UTSW 4 41,505,091 (GRCm38) missense
Predicted Primers PCR Primer
(F):5'- TGCAGCCTCTACTTACTGGG -3'
(R):5'- AATTAGGCCTTCTGTGCAGG -3'

Sequencing Primer
(F):5'- CTACTTACTGGGGTCACAAACTTG -3'
(R):5'- ATGGGCATTGCCTATCCTAAAAGG -3'
Posted On 2016-06-21