Incidental Mutation 'R5132:1110017D15Rik'
ID395860
Institutional Source Beutler Lab
Gene Symbol 1110017D15Rik
Ensembl Gene ENSMUSG00000028441
Gene NameRIKEN cDNA 1110017D15 gene
SynonymsSmrp1, Cbe1
MMRRC Submission 042720-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5132 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location41505009-41517333 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 41517178 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030152] [ENSMUST00000095126] [ENSMUST00000108049] [ENSMUST00000108050] [ENSMUST00000108052]
Predicted Effect probably benign
Transcript: ENSMUST00000030152
SMART Domains Protein: ENSMUSP00000030152
Gene: ENSMUSG00000028441

DomainStartEndE-ValueType
Pfam:SMRP1 1 260 3.3e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095126
SMART Domains Protein: ENSMUSP00000092744
Gene: ENSMUSG00000028441

DomainStartEndE-ValueType
Pfam:SMRP1 1 202 6.5e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108049
SMART Domains Protein: ENSMUSP00000103684
Gene: ENSMUSG00000028439

DomainStartEndE-ValueType
Pfam:FAM219A 26 157 2.7e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108050
SMART Domains Protein: ENSMUSP00000103685
Gene: ENSMUSG00000028439

DomainStartEndE-ValueType
Pfam:FAM219A 26 156 8.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108052
SMART Domains Protein: ENSMUSP00000103687
Gene: ENSMUSG00000028439

DomainStartEndE-ValueType
Pfam:FAM219A 37 168 1.6e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151164
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear- or perinuclear-localized protein with no predicted domains or similarity to other known proteins. Expression of this gene is induced during the differentiation of bronchial epithelial cells, and the encoded protein may play a role in ciliogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 A T 1: 156,641,832 K785* probably null Het
Acad11 A T 9: 104,126,592 I628L probably benign Het
Ago1 T C 4: 126,461,723 I98V probably benign Het
Bach2 A G 4: 32,563,396 probably benign Het
Calr3 C T 8: 72,431,368 probably null Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdc42ep3 C T 17: 79,335,374 R39H probably damaging Het
Cyp2j5 T C 4: 96,629,496 Y493C probably damaging Het
Ddx19b A T 8: 111,022,408 D66E probably benign Het
Drosha A G 15: 12,837,291 D287G unknown Het
Gm8888 A G 15: 96,767,011 noncoding transcript Het
Gpr25 G T 1: 136,260,365 A170E probably damaging Het
Gria1 A G 11: 57,289,399 Y656C probably damaging Het
Grik5 C T 7: 25,065,204 V145I probably benign Het
Htt T C 5: 34,905,679 V2885A possibly damaging Het
Larp6 A G 9: 60,737,210 E211G probably damaging Het
Magi1 C A 6: 93,683,091 probably null Het
Mtbp A G 15: 55,558,569 S63G possibly damaging Het
Ndor1 A T 2: 25,247,769 S513T probably benign Het
Nsd3 A G 8: 25,678,839 D670G possibly damaging Het
Olfr1118 A T 2: 87,308,938 M50L probably damaging Het
Olfr1299 T A 2: 111,664,999 Y258N probably damaging Het
Olfr513 T C 7: 108,755,270 V138A probably damaging Het
Pcdh7 T C 5: 57,728,121 V1061A probably benign Het
Pdia4 A G 6: 47,796,735 I560T probably benign Het
Pomt2 A G 12: 87,110,347 F733L probably damaging Het
Pprc1 T C 19: 46,072,682 probably benign Het
Prkca T C 11: 108,192,117 probably benign Het
Pspc1 A T 14: 56,723,250 S473T probably benign Het
Rgs12 A G 5: 34,989,812 probably benign Het
Scn3a C T 2: 65,468,204 V1384I probably benign Het
Serpinb6a C T 13: 33,918,322 D307N probably benign Het
Smap2 T C 4: 120,973,173 E255G possibly damaging Het
St7 A T 6: 17,854,957 I298F probably damaging Het
Tgm7 A G 2: 121,104,219 F93L probably damaging Het
Timm23 A T 14: 32,193,945 D56E probably damaging Het
Tmem170 A T 8: 111,869,725 M56K probably benign Het
Other mutations in 1110017D15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:1110017D15Rik APN 4 41507178 missense probably damaging 1.00
IGL01062:1110017D15Rik APN 4 41511433 missense probably damaging 1.00
IGL02645:1110017D15Rik APN 4 41517080 missense probably damaging 1.00
IGL03124:1110017D15Rik APN 4 41507287 missense possibly damaging 0.87
R0284:1110017D15Rik UTSW 4 41507538 missense probably damaging 1.00
R1760:1110017D15Rik UTSW 4 41507330 critical splice acceptor site probably null
R1761:1110017D15Rik UTSW 4 41507223 missense probably damaging 1.00
R2073:1110017D15Rik UTSW 4 41507519 critical splice donor site probably null
R2180:1110017D15Rik UTSW 4 41507170 missense probably benign 0.00
R4414:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4415:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4416:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4417:1110017D15Rik UTSW 4 41505574 missense possibly damaging 0.71
R4516:1110017D15Rik UTSW 4 41517200 unclassified probably benign
R6132:1110017D15Rik UTSW 4 41517160 start codon destroyed probably null 0.98
R6413:1110017D15Rik UTSW 4 41505135 missense possibly damaging 0.86
R8519:1110017D15Rik UTSW 4 41505071 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGCAGCCTCTACTTACTGGG -3'
(R):5'- AATTAGGCCTTCTGTGCAGG -3'

Sequencing Primer
(F):5'- CTACTTACTGGGGTCACAAACTTG -3'
(R):5'- ATGGGCATTGCCTATCCTAAAAGG -3'
Posted On2016-06-21