Incidental Mutation 'R5132:Ago1'
ID 395863
Institutional Source Beutler Lab
Gene Symbol Ago1
Ensembl Gene ENSMUSG00000041530
Gene Name argonaute RISC catalytic subunit 1
Synonyms Eif2c1, argonaute 1
MMRRC Submission 042720-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.789) question?
Stock # R5132 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 126328805-126362376 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 126355516 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 98 (I98V)
Ref Sequence ENSEMBL: ENSMUSP00000095498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]
AlphaFold Q8CJG1
Predicted Effect probably benign
Transcript: ENSMUST00000097888
AA Change: I98V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530
AA Change: I98V

DomainStartEndE-ValueType
Pfam:ArgoN 26 164 2.3e-26 PFAM
DUF1785 173 225 3.48e-25 SMART
PAZ 233 368 1.41e-5 SMART
Pfam:ArgoL2 373 418 3.6e-18 PFAM
Pfam:ArgoMid 427 509 7.6e-37 PFAM
Piwi 515 816 4.16e-131 SMART
Blast:Piwi 823 849 3e-6 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000127800
AA Change: I20V
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149425
Predicted Effect probably benign
Transcript: ENSMUST00000176315
SMART Domains Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530

DomainStartEndE-ValueType
Pfam:PAZ 1 62 4.1e-23 PFAM
Piwi 211 512 4.16e-131 SMART
Blast:Piwi 519 545 2e-6 BLAST
Meta Mutation Damage Score 0.0647 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 A T 1: 156,469,402 (GRCm39) K785* probably null Het
Acad11 A T 9: 104,003,791 (GRCm39) I628L probably benign Het
Bach2 A G 4: 32,563,396 (GRCm39) probably benign Het
Calr3 C T 8: 73,185,212 (GRCm39) probably null Het
Cdc23 C A 18: 34,784,742 (GRCm39) V7L unknown Het
Cdc42ep3 C T 17: 79,642,803 (GRCm39) R39H probably damaging Het
Cyp2j5 T C 4: 96,517,733 (GRCm39) Y493C probably damaging Het
Ddx19b A T 8: 111,749,040 (GRCm39) D66E probably benign Het
Drosha A G 15: 12,837,377 (GRCm39) D287G unknown Het
Gm8888 A G 15: 96,664,892 (GRCm39) noncoding transcript Het
Gpr25 G T 1: 136,188,103 (GRCm39) A170E probably damaging Het
Gria1 A G 11: 57,180,225 (GRCm39) Y656C probably damaging Het
Grik5 C T 7: 24,764,629 (GRCm39) V145I probably benign Het
Htt T C 5: 35,063,023 (GRCm39) V2885A possibly damaging Het
Larp6 A G 9: 60,644,493 (GRCm39) E211G probably damaging Het
Magi1 C A 6: 93,660,072 (GRCm39) probably null Het
Mtbp A G 15: 55,421,965 (GRCm39) S63G possibly damaging Het
Ndor1 A T 2: 25,137,781 (GRCm39) S513T probably benign Het
Nsd3 A G 8: 26,168,855 (GRCm39) D670G possibly damaging Het
Or10ag56 A T 2: 87,139,282 (GRCm39) M50L probably damaging Het
Or4k49 T A 2: 111,495,344 (GRCm39) Y258N probably damaging Het
Or5e1 T C 7: 108,354,477 (GRCm39) V138A probably damaging Het
Pcdh7 T C 5: 57,885,463 (GRCm39) V1061A probably benign Het
Pdia4 A G 6: 47,773,669 (GRCm39) I560T probably benign Het
Pomt2 A G 12: 87,157,121 (GRCm39) F733L probably damaging Het
Pprc1 T C 19: 46,061,121 (GRCm39) probably benign Het
Prkca T C 11: 108,082,943 (GRCm39) probably benign Het
Pspc1 A T 14: 56,960,707 (GRCm39) S473T probably benign Het
Rgs12 A G 5: 35,147,156 (GRCm39) probably benign Het
Scn3a C T 2: 65,298,548 (GRCm39) V1384I probably benign Het
Serpinb6a C T 13: 34,102,305 (GRCm39) D307N probably benign Het
Smap2 T C 4: 120,830,370 (GRCm39) E255G possibly damaging Het
Spmip6 A G 4: 41,517,178 (GRCm39) probably benign Het
St7 A T 6: 17,854,956 (GRCm39) I298F probably damaging Het
Tgm7 A G 2: 120,934,700 (GRCm39) F93L probably damaging Het
Timm23 A T 14: 31,915,902 (GRCm39) D56E probably damaging Het
Tmem170 A T 8: 112,596,357 (GRCm39) M56K probably benign Het
Other mutations in Ago1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Ago1 APN 4 126,353,610 (GRCm39) missense probably damaging 0.98
IGL02578:Ago1 APN 4 126,333,324 (GRCm39) missense probably benign 0.12
IGL02709:Ago1 APN 4 126,347,433 (GRCm39) nonsense probably null
IGL02810:Ago1 APN 4 126,336,886 (GRCm39) missense probably benign 0.00
IGL03037:Ago1 APN 4 126,355,587 (GRCm39) missense probably benign 0.00
IGL03091:Ago1 APN 4 126,352,982 (GRCm39) missense probably damaging 0.98
IGL03100:Ago1 APN 4 126,336,964 (GRCm39) missense probably benign 0.08
IGL03121:Ago1 APN 4 126,353,796 (GRCm39) missense probably benign 0.00
R0195:Ago1 UTSW 4 126,357,484 (GRCm39) missense probably benign 0.01
R0244:Ago1 UTSW 4 126,357,499 (GRCm39) missense possibly damaging 0.94
R0309:Ago1 UTSW 4 126,336,959 (GRCm39) missense probably benign 0.06
R0514:Ago1 UTSW 4 126,333,388 (GRCm39) missense probably benign
R0557:Ago1 UTSW 4 126,353,817 (GRCm39) missense probably benign 0.00
R1104:Ago1 UTSW 4 126,347,426 (GRCm39) missense probably damaging 0.99
R1553:Ago1 UTSW 4 126,334,194 (GRCm39) missense probably damaging 0.99
R1624:Ago1 UTSW 4 126,357,534 (GRCm39) missense probably damaging 0.97
R1851:Ago1 UTSW 4 126,333,788 (GRCm39) missense probably benign 0.00
R1867:Ago1 UTSW 4 126,335,029 (GRCm39) missense probably damaging 0.98
R2001:Ago1 UTSW 4 126,348,187 (GRCm39) missense probably null 0.36
R2051:Ago1 UTSW 4 126,354,246 (GRCm39) missense probably benign 0.01
R2057:Ago1 UTSW 4 126,337,021 (GRCm39) missense probably damaging 0.98
R2105:Ago1 UTSW 4 126,355,581 (GRCm39) missense probably benign 0.30
R2117:Ago1 UTSW 4 126,357,650 (GRCm39) splice site probably null
R2256:Ago1 UTSW 4 126,335,704 (GRCm39) missense possibly damaging 0.80
R2272:Ago1 UTSW 4 126,347,443 (GRCm39) missense probably benign 0.01
R2517:Ago1 UTSW 4 126,333,732 (GRCm39) nonsense probably null
R2850:Ago1 UTSW 4 126,336,868 (GRCm39) splice site probably benign
R2993:Ago1 UTSW 4 126,333,839 (GRCm39) splice site probably benign
R3746:Ago1 UTSW 4 126,354,837 (GRCm39) missense probably benign
R3747:Ago1 UTSW 4 126,354,837 (GRCm39) missense probably benign
R3750:Ago1 UTSW 4 126,354,837 (GRCm39) missense probably benign
R4600:Ago1 UTSW 4 126,354,185 (GRCm39) missense probably benign 0.37
R4934:Ago1 UTSW 4 126,342,652 (GRCm39) missense possibly damaging 0.56
R4983:Ago1 UTSW 4 126,347,447 (GRCm39) missense probably damaging 0.99
R5086:Ago1 UTSW 4 126,347,397 (GRCm39) missense probably benign 0.01
R5239:Ago1 UTSW 4 126,335,008 (GRCm39) missense probably damaging 1.00
R5609:Ago1 UTSW 4 126,354,830 (GRCm39) missense possibly damaging 0.80
R5705:Ago1 UTSW 4 126,342,587 (GRCm39) missense probably benign 0.01
R5980:Ago1 UTSW 4 126,354,362 (GRCm39) unclassified probably benign
R6036:Ago1 UTSW 4 126,337,021 (GRCm39) missense probably damaging 0.98
R6036:Ago1 UTSW 4 126,337,021 (GRCm39) missense probably damaging 0.98
R6398:Ago1 UTSW 4 126,342,601 (GRCm39) missense probably benign 0.26
R6505:Ago1 UTSW 4 126,357,628 (GRCm39) missense probably benign 0.00
R6545:Ago1 UTSW 4 126,348,145 (GRCm39) missense possibly damaging 0.74
R6944:Ago1 UTSW 4 126,354,215 (GRCm39) missense possibly damaging 0.78
R7041:Ago1 UTSW 4 126,357,499 (GRCm39) missense possibly damaging 0.94
R7490:Ago1 UTSW 4 126,333,298 (GRCm39) makesense probably null
R7496:Ago1 UTSW 4 126,355,545 (GRCm39) missense probably benign 0.20
R7575:Ago1 UTSW 4 126,347,701 (GRCm39) missense probably benign 0.12
R7625:Ago1 UTSW 4 126,337,022 (GRCm39) missense probably benign 0.18
R7988:Ago1 UTSW 4 126,354,210 (GRCm39) missense probably damaging 1.00
R8041:Ago1 UTSW 4 126,335,729 (GRCm39) missense probably damaging 1.00
R8073:Ago1 UTSW 4 126,337,019 (GRCm39) missense probably benign 0.04
R8086:Ago1 UTSW 4 126,354,774 (GRCm39) missense probably benign
R8127:Ago1 UTSW 4 126,348,214 (GRCm39) missense possibly damaging 0.95
R8772:Ago1 UTSW 4 126,354,316 (GRCm39) unclassified probably benign
R8878:Ago1 UTSW 4 126,357,516 (GRCm39) missense probably benign 0.35
R8989:Ago1 UTSW 4 126,357,583 (GRCm39) missense probably benign 0.01
R9140:Ago1 UTSW 4 126,336,977 (GRCm39) missense probably benign
X0025:Ago1 UTSW 4 126,336,908 (GRCm39) missense possibly damaging 0.47
Z1177:Ago1 UTSW 4 126,347,449 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAGCATCTACCCTGACTCATC -3'
(R):5'- ACCTGCCGGTTGATAGGAATG -3'

Sequencing Primer
(F):5'- ATCATGCCCCAAAATATACTTTTCC -3'
(R):5'- GCATACTGCCGAGGAGTAGAC -3'
Posted On 2016-06-21