Incidental Mutation 'R5132:Htt'
ID 395864
Institutional Source Beutler Lab
Gene Symbol Htt
Ensembl Gene ENSMUSG00000029104
Gene Name huntingtin
Synonyms Hdh, huntingtin, HD, IT15, htt, C430023I11Rik
MMRRC Submission 042720-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5132 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 34919084-35069878 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 35063023 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 2885 (V2885A)
Ref Sequence ENSEMBL: ENSMUSP00000078945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080036]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000080036
AA Change: V2885A

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078945
Gene: ENSMUSG00000029104
AA Change: V2885A

DomainStartEndE-ValueType
low complexity region 18 65 N/A INTRINSIC
SCOP:d1qgra_ 92 370 1e-12 SMART
low complexity region 371 388 N/A INTRINSIC
low complexity region 432 453 N/A INTRINSIC
low complexity region 1150 1161 N/A INTRINSIC
low complexity region 1423 1441 N/A INTRINSIC
Pfam:DUF3652 1494 1534 9.3e-20 PFAM
low complexity region 1812 1822 N/A INTRINSIC
Blast:GAF 1866 2040 1e-104 BLAST
low complexity region 2461 2472 N/A INTRINSIC
low complexity region 2611 2621 N/A INTRINSIC
low complexity region 2622 2635 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201636
Meta Mutation Damage Score 0.1731 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]
PHENOTYPE: Null mutants gastrulate abnormally and die in utero. Conditional mutants are small with progressive neurodegeneration. Knock-ins of 20-150 CAG repeat units variably mimic Huntington's with late-onset motor defects, reactive gliosis and neuronal inclusions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 A T 1: 156,469,402 (GRCm39) K785* probably null Het
Acad11 A T 9: 104,003,791 (GRCm39) I628L probably benign Het
Ago1 T C 4: 126,355,516 (GRCm39) I98V probably benign Het
Bach2 A G 4: 32,563,396 (GRCm39) probably benign Het
Calr3 C T 8: 73,185,212 (GRCm39) probably null Het
Cdc23 C A 18: 34,784,742 (GRCm39) V7L unknown Het
Cdc42ep3 C T 17: 79,642,803 (GRCm39) R39H probably damaging Het
Cyp2j5 T C 4: 96,517,733 (GRCm39) Y493C probably damaging Het
Ddx19b A T 8: 111,749,040 (GRCm39) D66E probably benign Het
Drosha A G 15: 12,837,377 (GRCm39) D287G unknown Het
Gm8888 A G 15: 96,664,892 (GRCm39) noncoding transcript Het
Gpr25 G T 1: 136,188,103 (GRCm39) A170E probably damaging Het
Gria1 A G 11: 57,180,225 (GRCm39) Y656C probably damaging Het
Grik5 C T 7: 24,764,629 (GRCm39) V145I probably benign Het
Larp6 A G 9: 60,644,493 (GRCm39) E211G probably damaging Het
Magi1 C A 6: 93,660,072 (GRCm39) probably null Het
Mtbp A G 15: 55,421,965 (GRCm39) S63G possibly damaging Het
Ndor1 A T 2: 25,137,781 (GRCm39) S513T probably benign Het
Nsd3 A G 8: 26,168,855 (GRCm39) D670G possibly damaging Het
Or10ag56 A T 2: 87,139,282 (GRCm39) M50L probably damaging Het
Or4k49 T A 2: 111,495,344 (GRCm39) Y258N probably damaging Het
Or5e1 T C 7: 108,354,477 (GRCm39) V138A probably damaging Het
Pcdh7 T C 5: 57,885,463 (GRCm39) V1061A probably benign Het
Pdia4 A G 6: 47,773,669 (GRCm39) I560T probably benign Het
Pomt2 A G 12: 87,157,121 (GRCm39) F733L probably damaging Het
Pprc1 T C 19: 46,061,121 (GRCm39) probably benign Het
Prkca T C 11: 108,082,943 (GRCm39) probably benign Het
Pspc1 A T 14: 56,960,707 (GRCm39) S473T probably benign Het
Rgs12 A G 5: 35,147,156 (GRCm39) probably benign Het
Scn3a C T 2: 65,298,548 (GRCm39) V1384I probably benign Het
Serpinb6a C T 13: 34,102,305 (GRCm39) D307N probably benign Het
Smap2 T C 4: 120,830,370 (GRCm39) E255G possibly damaging Het
Spmip6 A G 4: 41,517,178 (GRCm39) probably benign Het
St7 A T 6: 17,854,956 (GRCm39) I298F probably damaging Het
Tgm7 A G 2: 120,934,700 (GRCm39) F93L probably damaging Het
Timm23 A T 14: 31,915,902 (GRCm39) D56E probably damaging Het
Tmem170 A T 8: 112,596,357 (GRCm39) M56K probably benign Het
Other mutations in Htt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Htt APN 5 34,956,752 (GRCm39) missense probably benign 0.00
IGL00233:Htt APN 5 35,053,370 (GRCm39) splice site probably null
IGL00559:Htt APN 5 35,006,448 (GRCm39) splice site probably benign
IGL00765:Htt APN 5 35,034,769 (GRCm39) splice site probably benign
IGL00950:Htt APN 5 35,048,785 (GRCm39) missense probably benign
IGL00953:Htt APN 5 34,976,021 (GRCm39) missense probably benign 0.04
IGL00957:Htt APN 5 34,964,068 (GRCm39) missense probably benign
IGL01314:Htt APN 5 35,036,200 (GRCm39) missense probably benign
IGL01412:Htt APN 5 35,055,916 (GRCm39) missense probably damaging 0.98
IGL01510:Htt APN 5 35,064,856 (GRCm39) missense probably damaging 1.00
IGL01617:Htt APN 5 35,034,099 (GRCm39) missense possibly damaging 0.67
IGL01893:Htt APN 5 35,034,174 (GRCm39) missense probably damaging 1.00
IGL01914:Htt APN 5 34,987,053 (GRCm39) missense probably benign
IGL01994:Htt APN 5 34,989,948 (GRCm39) missense possibly damaging 0.83
IGL02102:Htt APN 5 35,048,825 (GRCm39) splice site probably benign
IGL02381:Htt APN 5 34,987,104 (GRCm39) missense probably benign 0.03
IGL02529:Htt APN 5 34,976,387 (GRCm39) splice site probably benign
IGL02678:Htt APN 5 35,057,246 (GRCm39) missense probably damaging 1.00
IGL02707:Htt APN 5 34,987,225 (GRCm39) critical splice donor site probably null
IGL02731:Htt APN 5 34,961,137 (GRCm39) missense probably benign 0.41
IGL02931:Htt APN 5 35,034,097 (GRCm39) missense probably damaging 1.00
IGL03167:Htt APN 5 34,976,330 (GRCm39) missense probably damaging 0.98
IGL03343:Htt APN 5 34,983,385 (GRCm39) missense probably benign
IGL03344:Htt APN 5 35,037,172 (GRCm39) missense probably benign 0.39
IGL03344:Htt APN 5 35,064,810 (GRCm39) missense probably benign 0.02
IGL03366:Htt APN 5 35,064,924 (GRCm39) missense probably damaging 1.00
IGL03410:Htt APN 5 34,956,789 (GRCm39) missense probably damaging 0.99
Chalk UTSW 5 35,064,430 (GRCm39) missense possibly damaging 0.86
IGL02796:Htt UTSW 5 35,034,826 (GRCm39) missense probably benign 0.43
PIT4377001:Htt UTSW 5 35,033,309 (GRCm39) missense probably benign 0.10
R0013:Htt UTSW 5 34,977,448 (GRCm39) missense probably benign 0.25
R0049:Htt UTSW 5 35,066,006 (GRCm39) missense probably damaging 0.97
R0049:Htt UTSW 5 35,066,006 (GRCm39) missense probably damaging 0.97
R0056:Htt UTSW 5 34,983,422 (GRCm39) splice site probably benign
R0207:Htt UTSW 5 35,054,252 (GRCm39) missense probably benign 0.11
R0329:Htt UTSW 5 34,974,478 (GRCm39) splice site probably benign
R0494:Htt UTSW 5 34,979,188 (GRCm39) missense possibly damaging 0.73
R0548:Htt UTSW 5 35,028,090 (GRCm39) missense probably damaging 1.00
R0601:Htt UTSW 5 35,003,347 (GRCm39) missense probably benign 0.08
R0799:Htt UTSW 5 34,975,097 (GRCm39) missense probably benign 0.00
R0947:Htt UTSW 5 35,056,268 (GRCm39) missense probably damaging 1.00
R1053:Htt UTSW 5 35,008,561 (GRCm39) critical splice acceptor site probably null
R1147:Htt UTSW 5 35,008,596 (GRCm39) missense probably damaging 0.98
R1147:Htt UTSW 5 35,008,596 (GRCm39) missense probably damaging 0.98
R1478:Htt UTSW 5 34,961,171 (GRCm39) missense probably damaging 0.99
R1573:Htt UTSW 5 35,021,718 (GRCm39) splice site probably benign
R1677:Htt UTSW 5 34,985,918 (GRCm39) missense probably damaging 1.00
R1792:Htt UTSW 5 35,064,543 (GRCm39) missense probably damaging 1.00
R1816:Htt UTSW 5 34,961,084 (GRCm39) missense probably benign 0.01
R1833:Htt UTSW 5 35,063,092 (GRCm39) splice site probably benign
R1837:Htt UTSW 5 34,976,367 (GRCm39) missense probably benign 0.00
R1846:Htt UTSW 5 35,006,288 (GRCm39) missense probably damaging 0.98
R1875:Htt UTSW 5 34,951,456 (GRCm39) missense probably benign 0.05
R1899:Htt UTSW 5 35,064,429 (GRCm39) missense probably benign 0.01
R2013:Htt UTSW 5 35,010,215 (GRCm39) missense probably damaging 0.99
R2062:Htt UTSW 5 34,983,326 (GRCm39) missense probably benign 0.00
R2064:Htt UTSW 5 34,983,326 (GRCm39) missense probably benign 0.00
R2067:Htt UTSW 5 34,983,326 (GRCm39) missense probably benign 0.00
R2068:Htt UTSW 5 34,983,326 (GRCm39) missense probably benign 0.00
R2131:Htt UTSW 5 35,034,453 (GRCm39) missense possibly damaging 0.50
R2162:Htt UTSW 5 34,979,062 (GRCm39) missense probably benign 0.44
R2169:Htt UTSW 5 35,034,819 (GRCm39) missense probably benign 0.08
R2345:Htt UTSW 5 34,983,348 (GRCm39) missense possibly damaging 0.80
R2433:Htt UTSW 5 35,064,885 (GRCm39) missense possibly damaging 0.65
R3027:Htt UTSW 5 34,977,439 (GRCm39) missense possibly damaging 0.85
R3123:Htt UTSW 5 34,961,875 (GRCm39) missense probably benign
R3125:Htt UTSW 5 34,961,875 (GRCm39) missense probably benign
R3717:Htt UTSW 5 34,968,866 (GRCm39) splice site probably benign
R3758:Htt UTSW 5 35,053,314 (GRCm39) missense probably damaging 0.97
R3805:Htt UTSW 5 35,034,548 (GRCm39) splice site probably null
R3833:Htt UTSW 5 34,979,062 (GRCm39) missense probably benign 0.44
R4066:Htt UTSW 5 35,036,191 (GRCm39) missense probably benign
R4272:Htt UTSW 5 35,006,413 (GRCm39) missense possibly damaging 0.96
R4625:Htt UTSW 5 34,987,129 (GRCm39) missense probably damaging 0.99
R4634:Htt UTSW 5 35,033,292 (GRCm39) missense probably benign 0.06
R4655:Htt UTSW 5 35,063,476 (GRCm39) missense probably benign 0.06
R4679:Htt UTSW 5 34,977,424 (GRCm39) missense probably benign
R4684:Htt UTSW 5 35,010,109 (GRCm39) missense probably damaging 1.00
R4832:Htt UTSW 5 34,982,184 (GRCm39) missense probably benign 0.01
R4833:Htt UTSW 5 35,009,569 (GRCm39) missense probably damaging 0.98
R4973:Htt UTSW 5 34,970,367 (GRCm39) missense probably damaging 0.99
R5095:Htt UTSW 5 34,981,739 (GRCm39) missense possibly damaging 0.89
R5351:Htt UTSW 5 34,961,177 (GRCm39) missense probably damaging 0.99
R5361:Htt UTSW 5 35,064,928 (GRCm39) missense possibly damaging 0.47
R5399:Htt UTSW 5 35,034,495 (GRCm39) missense probably damaging 0.98
R5462:Htt UTSW 5 35,042,851 (GRCm39) nonsense probably null
R5552:Htt UTSW 5 34,979,118 (GRCm39) missense probably benign
R5566:Htt UTSW 5 35,006,419 (GRCm39) missense probably damaging 1.00
R5595:Htt UTSW 5 35,062,741 (GRCm39) missense probably damaging 0.96
R5617:Htt UTSW 5 35,028,150 (GRCm39) missense possibly damaging 0.77
R5835:Htt UTSW 5 34,970,534 (GRCm39) missense probably benign 0.16
R5891:Htt UTSW 5 35,028,167 (GRCm39) missense possibly damaging 0.62
R6158:Htt UTSW 5 35,064,430 (GRCm39) missense possibly damaging 0.86
R6159:Htt UTSW 5 34,962,020 (GRCm39) missense probably benign 0.08
R6169:Htt UTSW 5 35,064,817 (GRCm39) missense probably damaging 1.00
R6242:Htt UTSW 5 35,003,356 (GRCm39) missense probably damaging 1.00
R6274:Htt UTSW 5 35,009,431 (GRCm39) missense possibly damaging 0.81
R6280:Htt UTSW 5 35,028,103 (GRCm39) missense probably benign 0.00
R6294:Htt UTSW 5 34,979,170 (GRCm39) missense probably benign
R6331:Htt UTSW 5 35,053,231 (GRCm39) missense possibly damaging 0.89
R6448:Htt UTSW 5 35,033,336 (GRCm39) missense probably benign 0.05
R6474:Htt UTSW 5 34,982,239 (GRCm39) missense probably benign 0.06
R6592:Htt UTSW 5 35,034,388 (GRCm39) missense possibly damaging 0.92
R6818:Htt UTSW 5 34,940,111 (GRCm39) missense probably damaging 0.99
R6830:Htt UTSW 5 34,991,670 (GRCm39) missense possibly damaging 0.82
R6920:Htt UTSW 5 35,034,444 (GRCm39) missense probably null 1.00
R6962:Htt UTSW 5 35,057,115 (GRCm39) critical splice acceptor site probably null
R7057:Htt UTSW 5 34,979,067 (GRCm39) missense probably null 0.05
R7144:Htt UTSW 5 35,003,350 (GRCm39) missense probably damaging 1.00
R7166:Htt UTSW 5 35,010,238 (GRCm39) missense probably benign 0.42
R7329:Htt UTSW 5 34,987,099 (GRCm39) missense probably benign 0.03
R7378:Htt UTSW 5 34,961,143 (GRCm39) missense probably benign 0.04
R7418:Htt UTSW 5 34,947,697 (GRCm39) missense possibly damaging 0.55
R7495:Htt UTSW 5 34,968,821 (GRCm39) missense probably benign 0.00
R7554:Htt UTSW 5 35,022,084 (GRCm39) missense probably damaging 0.97
R7575:Htt UTSW 5 35,062,987 (GRCm39) missense probably damaging 1.00
R7763:Htt UTSW 5 35,009,534 (GRCm39) missense probably damaging 1.00
R7782:Htt UTSW 5 35,040,336 (GRCm39) missense probably benign 0.03
R7850:Htt UTSW 5 35,009,631 (GRCm39) splice site probably null
R7870:Htt UTSW 5 35,055,891 (GRCm39) missense possibly damaging 0.77
R7871:Htt UTSW 5 35,021,993 (GRCm39) missense probably benign 0.00
R7879:Htt UTSW 5 34,981,252 (GRCm39) missense probably benign
R7992:Htt UTSW 5 34,987,225 (GRCm39) critical splice donor site probably null
R8058:Htt UTSW 5 34,977,444 (GRCm39) missense probably benign
R8168:Htt UTSW 5 35,040,300 (GRCm39) missense probably benign 0.00
R8188:Htt UTSW 5 34,919,287 (GRCm39) missense probably benign 0.03
R8262:Htt UTSW 5 35,053,304 (GRCm39) missense probably benign
R8343:Htt UTSW 5 35,063,068 (GRCm39) missense probably damaging 1.00
R8353:Htt UTSW 5 35,034,499 (GRCm39) missense possibly damaging 0.49
R8769:Htt UTSW 5 34,977,633 (GRCm39) missense probably benign 0.05
R8808:Htt UTSW 5 35,046,791 (GRCm39) missense probably benign 0.10
R8825:Htt UTSW 5 34,983,304 (GRCm39) missense probably benign 0.24
R8843:Htt UTSW 5 35,046,809 (GRCm39) missense possibly damaging 0.92
R8856:Htt UTSW 5 35,060,675 (GRCm39) missense probably benign 0.44
R8882:Htt UTSW 5 34,979,061 (GRCm39) missense probably benign
R8898:Htt UTSW 5 34,976,376 (GRCm39) missense probably benign 0.01
R8964:Htt UTSW 5 35,062,720 (GRCm39) missense probably benign 0.09
R8987:Htt UTSW 5 34,977,368 (GRCm39) missense probably benign 0.18
R8991:Htt UTSW 5 35,063,062 (GRCm39) missense probably damaging 1.00
R9005:Htt UTSW 5 34,975,095 (GRCm39) missense possibly damaging 0.92
R9019:Htt UTSW 5 35,023,920 (GRCm39) missense probably damaging 1.00
R9057:Htt UTSW 5 35,009,454 (GRCm39) missense possibly damaging 0.86
R9157:Htt UTSW 5 34,987,171 (GRCm39) missense probably null 0.89
R9205:Htt UTSW 5 34,976,367 (GRCm39) missense probably benign 0.00
R9223:Htt UTSW 5 35,062,692 (GRCm39) missense probably benign 0.01
R9243:Htt UTSW 5 35,056,276 (GRCm39) splice site probably benign
R9329:Htt UTSW 5 34,989,957 (GRCm39) missense possibly damaging 0.69
R9355:Htt UTSW 5 35,053,247 (GRCm39) missense probably benign
R9402:Htt UTSW 5 35,006,324 (GRCm39) missense probably damaging 1.00
R9446:Htt UTSW 5 34,919,272 (GRCm39) missense probably benign
R9716:Htt UTSW 5 35,012,019 (GRCm39) missense probably damaging 1.00
Z1177:Htt UTSW 5 35,009,575 (GRCm39) missense probably null 0.87
Predicted Primers PCR Primer
(F):5'- AGAGGGCTCTATTGAACATAGGC -3'
(R):5'- CTGGAAAGGTGACCAGGATGTC -3'

Sequencing Primer
(F):5'- GCTCTATTGAACATAGGCAGGTTACC -3'
(R):5'- TGTCTTAGGGCCACACTAAGACTG -3'
Posted On 2016-06-21