Incidental Mutation 'R5132:Pcdh7'
ID 395866
Institutional Source Beutler Lab
Gene Symbol Pcdh7
Ensembl Gene ENSMUSG00000029108
Gene Name protocadherin 7
Synonyms BH-protocadherin
MMRRC Submission 042720-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.134) question?
Stock # R5132 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 57717967-58133230 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57728121 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1061 (V1061A)
Ref Sequence ENSEMBL: ENSMUSP00000066306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068110] [ENSMUST00000094783] [ENSMUST00000191837] [ENSMUST00000199310]
AlphaFold A0A0A6YY83
Predicted Effect probably benign
Transcript: ENSMUST00000068110
AA Change: V1061A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066306
Gene: ENSMUSG00000029108
AA Change: V1061A

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094783
SMART Domains Protein: ENSMUSP00000092376
Gene: ENSMUSG00000029108

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
low complexity region 1088 1099 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191837
SMART Domains Protein: ENSMUSP00000142319
Gene: ENSMUSG00000029108

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 48 141 7.29e-4 SMART
CA 165 306 1.13e-18 SMART
CA 330 413 2.12e-23 SMART
CA 445 533 1.53e-20 SMART
CA 557 637 1.36e-26 SMART
CA 661 740 2.38e-26 SMART
CA 766 847 2.01e-15 SMART
transmembrane domain 878 900 N/A INTRINSIC
low complexity region 929 944 N/A INTRINSIC
low complexity region 1088 1099 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192048
Predicted Effect probably benign
Transcript: ENSMUST00000192287
Predicted Effect probably benign
Transcript: ENSMUST00000195156
Predicted Effect probably benign
Transcript: ENSMUST00000199310
SMART Domains Protein: ENSMUSP00000143387
Gene: ENSMUSG00000029108

DomainStartEndE-ValueType
Pfam:Protocadherin 1 79 5.1e-40 PFAM
low complexity region 112 123 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200266
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The gene encodes a protein with an extracellular domain containing 7 cadherin repeats. The gene product is an integral membrane protein that is thought to function in cell-cell recognition and adhesion. Alternative splicing yields isoforms with unique cytoplasmic tails. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A G 4: 41,517,178 (GRCm38) probably benign Het
Abl2 A T 1: 156,641,832 (GRCm38) K785* probably null Het
Acad11 A T 9: 104,126,592 (GRCm38) I628L probably benign Het
Ago1 T C 4: 126,461,723 (GRCm38) I98V probably benign Het
Bach2 A G 4: 32,563,396 (GRCm38) probably benign Het
Calr3 C T 8: 72,431,368 (GRCm38) probably null Het
Cdc23 C A 18: 34,651,689 (GRCm38) V7L unknown Het
Cdc42ep3 C T 17: 79,335,374 (GRCm38) R39H probably damaging Het
Cyp2j5 T C 4: 96,629,496 (GRCm38) Y493C probably damaging Het
Ddx19b A T 8: 111,022,408 (GRCm38) D66E probably benign Het
Drosha A G 15: 12,837,291 (GRCm38) D287G unknown Het
Gm8888 A G 15: 96,767,011 (GRCm38) noncoding transcript Het
Gpr25 G T 1: 136,260,365 (GRCm38) A170E probably damaging Het
Gria1 A G 11: 57,289,399 (GRCm38) Y656C probably damaging Het
Grik5 C T 7: 25,065,204 (GRCm38) V145I probably benign Het
Htt T C 5: 34,905,679 (GRCm38) V2885A possibly damaging Het
Larp6 A G 9: 60,737,210 (GRCm38) E211G probably damaging Het
Magi1 C A 6: 93,683,091 (GRCm38) probably null Het
Mtbp A G 15: 55,558,569 (GRCm38) S63G possibly damaging Het
Ndor1 A T 2: 25,247,769 (GRCm38) S513T probably benign Het
Nsd3 A G 8: 25,678,839 (GRCm38) D670G possibly damaging Het
Olfr1118 A T 2: 87,308,938 (GRCm38) M50L probably damaging Het
Olfr1299 T A 2: 111,664,999 (GRCm38) Y258N probably damaging Het
Olfr513 T C 7: 108,755,270 (GRCm38) V138A probably damaging Het
Pdia4 A G 6: 47,796,735 (GRCm38) I560T probably benign Het
Pomt2 A G 12: 87,110,347 (GRCm38) F733L probably damaging Het
Pprc1 T C 19: 46,072,682 (GRCm38) probably benign Het
Prkca T C 11: 108,192,117 (GRCm38) probably benign Het
Pspc1 A T 14: 56,723,250 (GRCm38) S473T probably benign Het
Rgs12 A G 5: 34,989,812 (GRCm38) probably benign Het
Scn3a C T 2: 65,468,204 (GRCm38) V1384I probably benign Het
Serpinb6a C T 13: 33,918,322 (GRCm38) D307N probably benign Het
Smap2 T C 4: 120,973,173 (GRCm38) E255G possibly damaging Het
St7 A T 6: 17,854,957 (GRCm38) I298F probably damaging Het
Tgm7 A G 2: 121,104,219 (GRCm38) F93L probably damaging Het
Timm23 A T 14: 32,193,945 (GRCm38) D56E probably damaging Het
Tmem170 A T 8: 111,869,725 (GRCm38) M56K probably benign Het
Other mutations in Pcdh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Pcdh7 APN 5 57,721,464 (GRCm38) missense probably damaging 1.00
IGL00920:Pcdh7 APN 5 57,720,131 (GRCm38) missense probably damaging 0.96
IGL00990:Pcdh7 APN 5 57,720,464 (GRCm38) missense possibly damaging 0.94
IGL01367:Pcdh7 APN 5 58,129,224 (GRCm38) missense possibly damaging 0.67
IGL01388:Pcdh7 APN 5 57,720,204 (GRCm38) missense probably damaging 1.00
IGL01543:Pcdh7 APN 5 57,720,765 (GRCm38) missense probably damaging 1.00
IGL01750:Pcdh7 APN 5 57,720,422 (GRCm38) missense probably damaging 1.00
IGL02010:Pcdh7 APN 5 58,129,255 (GRCm38) missense probably benign
IGL02014:Pcdh7 APN 5 57,719,703 (GRCm38) missense probably benign 0.03
IGL02269:Pcdh7 APN 5 57,913,322 (GRCm38) missense probably damaging 1.00
IGL03051:Pcdh7 APN 5 58,129,073 (GRCm38) missense probably damaging 0.99
floated UTSW 5 57,721,362 (GRCm38) missense probably damaging 1.00
proposed UTSW 5 57,722,240 (GRCm38) missense probably damaging 0.99
P0037:Pcdh7 UTSW 5 57,913,248 (GRCm38) missense probably benign 0.17
R0003:Pcdh7 UTSW 5 57,913,248 (GRCm38) missense probably benign 0.17
R0421:Pcdh7 UTSW 5 57,720,060 (GRCm38) missense probably damaging 1.00
R0551:Pcdh7 UTSW 5 57,721,994 (GRCm38) missense probably damaging 0.99
R0562:Pcdh7 UTSW 5 57,720,063 (GRCm38) missense probably damaging 0.99
R0732:Pcdh7 UTSW 5 57,721,315 (GRCm38) missense probably damaging 1.00
R0755:Pcdh7 UTSW 5 57,720,322 (GRCm38) missense possibly damaging 0.86
R1080:Pcdh7 UTSW 5 57,719,426 (GRCm38) missense probably damaging 1.00
R1381:Pcdh7 UTSW 5 57,721,540 (GRCm38) nonsense probably null
R1591:Pcdh7 UTSW 5 57,720,422 (GRCm38) missense probably damaging 1.00
R1891:Pcdh7 UTSW 5 57,720,875 (GRCm38) missense probably damaging 0.98
R2011:Pcdh7 UTSW 5 57,719,629 (GRCm38) missense probably damaging 1.00
R2140:Pcdh7 UTSW 5 58,128,996 (GRCm38) missense probably damaging 1.00
R2147:Pcdh7 UTSW 5 58,129,116 (GRCm38) missense possibly damaging 0.51
R2848:Pcdh7 UTSW 5 57,720,276 (GRCm38) missense probably damaging 1.00
R2867:Pcdh7 UTSW 5 57,721,894 (GRCm38) missense probably damaging 1.00
R2867:Pcdh7 UTSW 5 57,721,894 (GRCm38) missense probably damaging 1.00
R3719:Pcdh7 UTSW 5 58,129,032 (GRCm38) missense probably damaging 1.00
R4075:Pcdh7 UTSW 5 57,721,808 (GRCm38) missense probably damaging 1.00
R4231:Pcdh7 UTSW 5 57,719,289 (GRCm38) missense possibly damaging 0.94
R4236:Pcdh7 UTSW 5 57,719,289 (GRCm38) missense possibly damaging 0.94
R4352:Pcdh7 UTSW 5 57,722,019 (GRCm38) missense possibly damaging 0.88
R4420:Pcdh7 UTSW 5 58,129,170 (GRCm38) missense probably benign 0.03
R4449:Pcdh7 UTSW 5 57,720,485 (GRCm38) missense probably damaging 1.00
R4584:Pcdh7 UTSW 5 57,721,283 (GRCm38) missense probably damaging 1.00
R4686:Pcdh7 UTSW 5 58,129,169 (GRCm38) missense probably benign
R4837:Pcdh7 UTSW 5 57,720,411 (GRCm38) missense possibly damaging 0.89
R4838:Pcdh7 UTSW 5 57,720,804 (GRCm38) missense probably damaging 1.00
R4947:Pcdh7 UTSW 5 57,721,916 (GRCm38) missense probably damaging 0.98
R5053:Pcdh7 UTSW 5 57,721,601 (GRCm38) missense probably damaging 0.99
R5068:Pcdh7 UTSW 5 57,722,166 (GRCm38) missense probably damaging 1.00
R5117:Pcdh7 UTSW 5 57,721,748 (GRCm38) missense probably benign 0.09
R5248:Pcdh7 UTSW 5 58,129,173 (GRCm38) missense probably damaging 0.97
R5294:Pcdh7 UTSW 5 57,728,111 (GRCm38) splice site probably null
R5420:Pcdh7 UTSW 5 57,720,187 (GRCm38) missense probably damaging 1.00
R5777:Pcdh7 UTSW 5 57,719,514 (GRCm38) missense probably damaging 1.00
R5800:Pcdh7 UTSW 5 57,722,225 (GRCm38) missense probably damaging 1.00
R5834:Pcdh7 UTSW 5 57,721,628 (GRCm38) missense possibly damaging 0.90
R5870:Pcdh7 UTSW 5 57,720,411 (GRCm38) missense possibly damaging 0.89
R5917:Pcdh7 UTSW 5 57,721,755 (GRCm38) missense probably damaging 0.96
R6014:Pcdh7 UTSW 5 57,721,155 (GRCm38) missense probably damaging 0.99
R6193:Pcdh7 UTSW 5 57,720,324 (GRCm38) missense probably damaging 1.00
R6240:Pcdh7 UTSW 5 57,721,362 (GRCm38) missense probably damaging 1.00
R6335:Pcdh7 UTSW 5 57,942,265 (GRCm38) splice site probably null
R6418:Pcdh7 UTSW 5 57,721,704 (GRCm38) missense probably damaging 1.00
R6907:Pcdh7 UTSW 5 57,719,129 (GRCm38) missense possibly damaging 0.53
R7058:Pcdh7 UTSW 5 57,722,240 (GRCm38) missense probably damaging 0.99
R7069:Pcdh7 UTSW 5 57,719,784 (GRCm38) missense probably benign 0.00
R7073:Pcdh7 UTSW 5 57,720,957 (GRCm38) missense probably benign 0.19
R7463:Pcdh7 UTSW 5 57,720,998 (GRCm38) missense probably benign 0.06
R7509:Pcdh7 UTSW 5 57,720,187 (GRCm38) missense probably damaging 1.00
R7588:Pcdh7 UTSW 5 57,719,904 (GRCm38) missense probably damaging 1.00
R7707:Pcdh7 UTSW 5 57,720,330 (GRCm38) missense probably damaging 0.99
R7734:Pcdh7 UTSW 5 57,719,634 (GRCm38) missense probably damaging 0.99
R7899:Pcdh7 UTSW 5 57,719,810 (GRCm38) missense probably benign
R8194:Pcdh7 UTSW 5 57,720,336 (GRCm38) missense probably damaging 1.00
R8480:Pcdh7 UTSW 5 58,129,065 (GRCm38) missense probably damaging 1.00
R8890:Pcdh7 UTSW 5 57,719,375 (GRCm38) missense probably damaging 1.00
R8906:Pcdh7 UTSW 5 57,721,812 (GRCm38) missense probably damaging 1.00
R8990:Pcdh7 UTSW 5 57,722,022 (GRCm38) missense probably benign 0.06
R9264:Pcdh7 UTSW 5 58,129,321 (GRCm38) missense probably benign 0.09
R9272:Pcdh7 UTSW 5 57,721,437 (GRCm38) missense possibly damaging 0.81
R9294:Pcdh7 UTSW 5 57,721,335 (GRCm38) missense probably benign 0.39
R9518:Pcdh7 UTSW 5 57,913,171 (GRCm38) missense possibly damaging 0.81
R9597:Pcdh7 UTSW 5 57,719,855 (GRCm38) missense possibly damaging 0.68
R9642:Pcdh7 UTSW 5 57,719,375 (GRCm38) missense probably damaging 1.00
R9745:Pcdh7 UTSW 5 57,722,280 (GRCm38) critical splice donor site probably null
X0021:Pcdh7 UTSW 5 57,721,484 (GRCm38) missense possibly damaging 0.95
X0026:Pcdh7 UTSW 5 57,719,379 (GRCm38) missense probably damaging 1.00
Z1177:Pcdh7 UTSW 5 57,719,664 (GRCm38) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TAAGGCTCCTGATGTTGGATTC -3'
(R):5'- GCTTGGAAACATAATGCACAAC -3'

Sequencing Primer
(F):5'- CTGATGTTGGATTCCTCTGACAAATC -3'
(R):5'- CAAGGAAAACAAACAGTGATTGGCTG -3'
Posted On 2016-06-21