Mutagenetix > Incidental Mutation

Incidental Mutation 'R5132:St7'

395867

Institutional Source

Beutler Lab

Gene Symbol

St7

Ensembl Gene

ENSMUSG00000029534

Gene Name

suppression of tumorigenicity 7

Synonyms

RAY1, SEN4, Fam4a2, TSG7, 9430001H04Rik, HELG

MMRRC Submission

042720-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.155) question?

Stock #

R5132 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

17692933-17943025 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 17854957 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 298 (I298F)

Ref Sequence

ENSEMBL: ENSMUSP00000111079 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000674] [ENSMUST00000052113] [ENSMUST00000053148] [ENSMUST00000077080] [ENSMUST00000081635] [ENSMUST00000115417] [ENSMUST00000115418] [ENSMUST00000115419] [ENSMUST00000115420] [ENSMUST00000125673] [ENSMUST00000144488] [ENSMUST00000150281]

AlphaFold

Q99M96

Predicted Effect

probably benign
Transcript: ENSMUST00000000674
AA Change: I229F

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000000674
Gene: ENSMUSG00000029534
AA Change: I229F

Domain	Start	End	E-Value	Type
Pfam:ST7	2	507	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000052113
AA Change: I275F

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000062886
Gene: ENSMUSG00000029534
AA Change: I275F

Domain	Start	End	E-Value	Type
Pfam:ST7	16	554	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053148
AA Change: I255F

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000057326
Gene: ENSMUSG00000029534
AA Change: I255F

Domain	Start	End	E-Value	Type
Pfam:ST7	3	534	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077080
AA Change: I252F

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000076334
Gene: ENSMUSG00000029534
AA Change: I252F

Domain	Start	End	E-Value	Type
Pfam:ST7	2	531	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000081635
AA Change: I298F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000080341
Gene: ENSMUSG00000029534
AA Change: I298F

Domain	Start	End	E-Value	Type
Pfam:ST7	17	576	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115417
AA Change: I232F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000111077
Gene: ENSMUSG00000029534
AA Change: I232F

Domain	Start	End	E-Value	Type
Pfam:ST7	3	511	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115418
AA Change: I275F

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000111078
Gene: ENSMUSG00000029534
AA Change: I275F

Domain	Start	End	E-Value	Type
Pfam:ST7	16	480	5e-278	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115419
AA Change: I298F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000111079
Gene: ENSMUSG00000029534
AA Change: I298F

Domain	Start	End	E-Value	Type
Pfam:ST7	16	572	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115420
AA Change: I275F

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000111080
Gene: ENSMUSG00000029534
AA Change: I275F

Domain	Start	End	E-Value	Type
Pfam:ST7	16	448	2.5e-278	PFAM
Pfam:ST7	445	523	2e-31	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125673

SMART Domains

Protein: ENSMUSP00000122970
Gene: ENSMUSG00000029534

Domain	Start	End	E-Value	Type
Pfam:ST7	16	52	1.9e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127181
AA Change: Y281F

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138726

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140358

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144021
AA Change: Y304F

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144743

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154059

Predicted Effect

probably benign
Transcript: ENSMUST00000144488

SMART Domains

Protein: ENSMUSP00000115215
Gene: ENSMUSG00000029534

Domain	Start	End	E-Value	Type
Pfam:ST7	16	82	6.3e-33	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000150281

SMART Domains

Protein: ENSMUSP00000116304
Gene: ENSMUSG00000029534

Domain	Start	End	E-Value	Type
Pfam:ST7	16	58	1.9e-15	PFAM

Meta Mutation Damage Score

0.4736

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene for this product maps to a region on chromosome 7 identified as an autism-susceptibility locus. Mutation screening of the entire coding region in autistic individuals failed to identify phenotype-specific variants, suggesting that coding mutations for this gene are unlikely to be involved in the etiology of autism. The function of this gene product has not been determined. Transcript variants encoding different isoforms of this protein have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	A	G	4: 41,517,178		probably benign	Het
Abl2	A	T	1: 156,641,832	K785*	probably null	Het
Acad11	A	T	9: 104,126,592	I628L	probably benign	Het
Ago1	T	C	4: 126,461,723	I98V	probably benign	Het
Bach2	A	G	4: 32,563,396		probably benign	Het
Calr3	C	T	8: 72,431,368		probably null	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Cdc42ep3	C	T	17: 79,335,374	R39H	probably damaging	Het
Cyp2j5	T	C	4: 96,629,496	Y493C	probably damaging	Het
Ddx19b	A	T	8: 111,022,408	D66E	probably benign	Het
Drosha	A	G	15: 12,837,291	D287G	unknown	Het
Gm8888	A	G	15: 96,767,011		noncoding transcript	Het
Gpr25	G	T	1: 136,260,365	A170E	probably damaging	Het
Gria1	A	G	11: 57,289,399	Y656C	probably damaging	Het
Grik5	C	T	7: 25,065,204	V145I	probably benign	Het
Htt	T	C	5: 34,905,679	V2885A	possibly damaging	Het
Larp6	A	G	9: 60,737,210	E211G	probably damaging	Het
Magi1	C	A	6: 93,683,091		probably null	Het
Mtbp	A	G	15: 55,558,569	S63G	possibly damaging	Het
Ndor1	A	T	2: 25,247,769	S513T	probably benign	Het
Nsd3	A	G	8: 25,678,839	D670G	possibly damaging	Het
Olfr1118	A	T	2: 87,308,938	M50L	probably damaging	Het
Olfr1299	T	A	2: 111,664,999	Y258N	probably damaging	Het
Olfr513	T	C	7: 108,755,270	V138A	probably damaging	Het
Pcdh7	T	C	5: 57,728,121	V1061A	probably benign	Het
Pdia4	A	G	6: 47,796,735	I560T	probably benign	Het
Pomt2	A	G	12: 87,110,347	F733L	probably damaging	Het
Pprc1	T	C	19: 46,072,682		probably benign	Het
Prkca	T	C	11: 108,192,117		probably benign	Het
Pspc1	A	T	14: 56,723,250	S473T	probably benign	Het
Rgs12	A	G	5: 34,989,812		probably benign	Het
Scn3a	C	T	2: 65,468,204	V1384I	probably benign	Het
Serpinb6a	C	T	13: 33,918,322	D307N	probably benign	Het
Smap2	T	C	4: 120,973,173	E255G	possibly damaging	Het
Tgm7	A	G	2: 121,104,219	F93L	probably damaging	Het
Timm23	A	T	14: 32,193,945	D56E	probably damaging	Het
Tmem170	A	T	8: 111,869,725	M56K	probably benign	Het

Other mutations in St7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:St7	APN	6	17855006	missense	probably damaging	1.00
IGL01312:St7	APN	6	17922014	missense	probably damaging	1.00
IGL01562:St7	APN	6	17922035	missense	probably damaging	0.99
IGL01935:St7	APN	6	17930823	missense	probably damaging	0.99
IGL02127:St7	APN	6	17844969	intron	probably benign
IGL02954:St7	APN	6	17848031	missense	probably damaging	1.00
IGL02980:St7	UTSW	6	17749546	intron	probably benign
R0457:St7	UTSW	6	17819282	missense	probably damaging	1.00
R0666:St7	UTSW	6	17934239	missense	probably damaging	1.00
R0680:St7	UTSW	6	17942733	missense	probably damaging	0.99
R1575:St7	UTSW	6	17886111	missense	probably damaging	1.00
R2039:St7	UTSW	6	17886112	missense	probably damaging	1.00
R2144:St7	UTSW	6	17886007	missense	possibly damaging	0.58
R2194:St7	UTSW	6	17942719	missense	probably damaging	1.00
R2869:St7	UTSW	6	17819277	missense	probably damaging	1.00
R2869:St7	UTSW	6	17819277	missense	probably damaging	1.00
R2873:St7	UTSW	6	17819277	missense	probably damaging	1.00
R2874:St7	UTSW	6	17819277	missense	probably damaging	1.00
R2970:St7	UTSW	6	17844909	missense	probably damaging	1.00
R3076:St7	UTSW	6	17846238	nonsense	probably null
R3921:St7	UTSW	6	17846245	missense	probably benign	0.31
R4326:St7	UTSW	6	17819288	missense	probably damaging	1.00
R4327:St7	UTSW	6	17819288	missense	probably damaging	1.00
R4410:St7	UTSW	6	17854933	nonsense	probably null
R4732:St7	UTSW	6	17906516	splice site	probably null
R4733:St7	UTSW	6	17906516	splice site	probably null
R4868:St7	UTSW	6	17819266	missense	probably damaging	1.00
R4988:St7	UTSW	6	17934226	missense	probably damaging	0.99
R5182:St7	UTSW	6	17846237	missense	probably damaging	0.99
R5195:St7	UTSW	6	17743637	intron	probably benign
R5358:St7	UTSW	6	17819318	missense	probably damaging	1.00
R5502:St7	UTSW	6	17834674	missense	possibly damaging	0.94
R5882:St7	UTSW	6	17846249	missense	probably damaging	1.00
R5976:St7	UTSW	6	17694222	missense	possibly damaging	0.93
R6049:St7	UTSW	6	17694348	missense	possibly damaging	0.92
R6139:St7	UTSW	6	17694354	missense	probably damaging	1.00
R6177:St7	UTSW	6	17819334	critical splice donor site	probably null
R6181:St7	UTSW	6	17694364	critical splice donor site	probably null
R6401:St7	UTSW	6	17855318	splice site	probably null
R6546:St7	UTSW	6	17852314	missense	probably damaging	1.00
R6711:St7	UTSW	6	17848070	missense	possibly damaging	0.82
R6898:St7	UTSW	6	17854946	missense	probably damaging	1.00
R7536:St7	UTSW	6	17886020	missense	probably damaging	0.99
R7583:St7	UTSW	6	17942754	missense	possibly damaging	0.54
R7626:St7	UTSW	6	17934217	missense	probably damaging	1.00
R7718:St7	UTSW	6	17854999	missense	probably damaging	0.99
R7943:St7	UTSW	6	17844912	missense	probably damaging	1.00
R8334:St7	UTSW	6	17934221	missense	probably damaging	1.00
R8415:St7	UTSW	6	17848081	critical splice donor site	probably null
R9018:St7	UTSW	6	17906495	missense	probably damaging	1.00
R9217:St7	UTSW	6	17846272	missense	probably damaging	0.98
R9294:St7	UTSW	6	17844914	nonsense	probably null
Z1176:St7	UTSW	6	17848045	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TAGCACAAATGAGCCTCTGC -3'
(R):5'- AAGCTGGCTTAGGCACTTATG -3'

Sequencing Primer
(F):5'- AGTTTGCAAGTCCAATGGGCC -3'
(R):5'- GTGACTATGGTATTATCATGGCTCAG -3'

Posted On

2016-06-21