Incidental Mutation 'R5132:St7'
ID 395867
Institutional Source Beutler Lab
Gene Symbol St7
Ensembl Gene ENSMUSG00000029534
Gene Name suppression of tumorigenicity 7
Synonyms RAY1, HELG, TSG7, Fam4a2, 9430001H04Rik, SEN4
MMRRC Submission 042720-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.147) question?
Stock # R5132 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 17693579-17943022 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 17854956 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 298 (I298F)
Ref Sequence ENSEMBL: ENSMUSP00000111079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000674] [ENSMUST00000052113] [ENSMUST00000053148] [ENSMUST00000077080] [ENSMUST00000081635] [ENSMUST00000115417] [ENSMUST00000115418] [ENSMUST00000115419] [ENSMUST00000115420] [ENSMUST00000144488] [ENSMUST00000150281] [ENSMUST00000125673]
AlphaFold Q99M96
Predicted Effect probably benign
Transcript: ENSMUST00000000674
AA Change: I229F

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000000674
Gene: ENSMUSG00000029534
AA Change: I229F

DomainStartEndE-ValueType
Pfam:ST7 2 507 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000052113
AA Change: I275F

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062886
Gene: ENSMUSG00000029534
AA Change: I275F

DomainStartEndE-ValueType
Pfam:ST7 16 554 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000053148
AA Change: I255F

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057326
Gene: ENSMUSG00000029534
AA Change: I255F

DomainStartEndE-ValueType
Pfam:ST7 3 534 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000077080
AA Change: I252F

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076334
Gene: ENSMUSG00000029534
AA Change: I252F

DomainStartEndE-ValueType
Pfam:ST7 2 531 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000081635
AA Change: I298F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080341
Gene: ENSMUSG00000029534
AA Change: I298F

DomainStartEndE-ValueType
Pfam:ST7 17 576 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115417
AA Change: I232F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000111077
Gene: ENSMUSG00000029534
AA Change: I232F

DomainStartEndE-ValueType
Pfam:ST7 3 511 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115418
AA Change: I275F

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111078
Gene: ENSMUSG00000029534
AA Change: I275F

DomainStartEndE-ValueType
Pfam:ST7 16 480 5e-278 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115419
AA Change: I298F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111079
Gene: ENSMUSG00000029534
AA Change: I298F

DomainStartEndE-ValueType
Pfam:ST7 16 572 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115420
AA Change: I275F

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000111080
Gene: ENSMUSG00000029534
AA Change: I275F

DomainStartEndE-ValueType
Pfam:ST7 16 448 2.5e-278 PFAM
Pfam:ST7 445 523 2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127181
AA Change: Y281F
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144021
AA Change: Y304F
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154059
Predicted Effect probably benign
Transcript: ENSMUST00000144488
SMART Domains Protein: ENSMUSP00000115215
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 82 6.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150281
SMART Domains Protein: ENSMUSP00000116304
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 58 1.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125673
SMART Domains Protein: ENSMUSP00000122970
Gene: ENSMUSG00000029534

DomainStartEndE-ValueType
Pfam:ST7 16 52 1.9e-14 PFAM
Meta Mutation Damage Score 0.4736 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene for this product maps to a region on chromosome 7 identified as an autism-susceptibility locus. Mutation screening of the entire coding region in autistic individuals failed to identify phenotype-specific variants, suggesting that coding mutations for this gene are unlikely to be involved in the etiology of autism. The function of this gene product has not been determined. Transcript variants encoding different isoforms of this protein have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 A T 1: 156,469,402 (GRCm39) K785* probably null Het
Acad11 A T 9: 104,003,791 (GRCm39) I628L probably benign Het
Ago1 T C 4: 126,355,516 (GRCm39) I98V probably benign Het
Bach2 A G 4: 32,563,396 (GRCm39) probably benign Het
Calr3 C T 8: 73,185,212 (GRCm39) probably null Het
Cdc23 C A 18: 34,784,742 (GRCm39) V7L unknown Het
Cdc42ep3 C T 17: 79,642,803 (GRCm39) R39H probably damaging Het
Cyp2j5 T C 4: 96,517,733 (GRCm39) Y493C probably damaging Het
Ddx19b A T 8: 111,749,040 (GRCm39) D66E probably benign Het
Drosha A G 15: 12,837,377 (GRCm39) D287G unknown Het
Gm8888 A G 15: 96,664,892 (GRCm39) noncoding transcript Het
Gpr25 G T 1: 136,188,103 (GRCm39) A170E probably damaging Het
Gria1 A G 11: 57,180,225 (GRCm39) Y656C probably damaging Het
Grik5 C T 7: 24,764,629 (GRCm39) V145I probably benign Het
Htt T C 5: 35,063,023 (GRCm39) V2885A possibly damaging Het
Larp6 A G 9: 60,644,493 (GRCm39) E211G probably damaging Het
Magi1 C A 6: 93,660,072 (GRCm39) probably null Het
Mtbp A G 15: 55,421,965 (GRCm39) S63G possibly damaging Het
Ndor1 A T 2: 25,137,781 (GRCm39) S513T probably benign Het
Nsd3 A G 8: 26,168,855 (GRCm39) D670G possibly damaging Het
Or10ag56 A T 2: 87,139,282 (GRCm39) M50L probably damaging Het
Or4k49 T A 2: 111,495,344 (GRCm39) Y258N probably damaging Het
Or5e1 T C 7: 108,354,477 (GRCm39) V138A probably damaging Het
Pcdh7 T C 5: 57,885,463 (GRCm39) V1061A probably benign Het
Pdia4 A G 6: 47,773,669 (GRCm39) I560T probably benign Het
Pomt2 A G 12: 87,157,121 (GRCm39) F733L probably damaging Het
Pprc1 T C 19: 46,061,121 (GRCm39) probably benign Het
Prkca T C 11: 108,082,943 (GRCm39) probably benign Het
Pspc1 A T 14: 56,960,707 (GRCm39) S473T probably benign Het
Rgs12 A G 5: 35,147,156 (GRCm39) probably benign Het
Scn3a C T 2: 65,298,548 (GRCm39) V1384I probably benign Het
Serpinb6a C T 13: 34,102,305 (GRCm39) D307N probably benign Het
Smap2 T C 4: 120,830,370 (GRCm39) E255G possibly damaging Het
Spmip6 A G 4: 41,517,178 (GRCm39) probably benign Het
Tgm7 A G 2: 120,934,700 (GRCm39) F93L probably damaging Het
Timm23 A T 14: 31,915,902 (GRCm39) D56E probably damaging Het
Tmem170 A T 8: 112,596,357 (GRCm39) M56K probably benign Het
Other mutations in St7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:St7 APN 6 17,855,005 (GRCm39) missense probably damaging 1.00
IGL01312:St7 APN 6 17,922,013 (GRCm39) missense probably damaging 1.00
IGL01562:St7 APN 6 17,922,034 (GRCm39) missense probably damaging 0.99
IGL01935:St7 APN 6 17,930,822 (GRCm39) missense probably damaging 0.99
IGL02127:St7 APN 6 17,844,968 (GRCm39) intron probably benign
IGL02954:St7 APN 6 17,848,030 (GRCm39) missense probably damaging 1.00
IGL02980:St7 UTSW 6 17,749,545 (GRCm39) intron probably benign
R0457:St7 UTSW 6 17,819,281 (GRCm39) missense probably damaging 1.00
R0666:St7 UTSW 6 17,934,238 (GRCm39) missense probably damaging 1.00
R0680:St7 UTSW 6 17,942,732 (GRCm39) missense probably damaging 0.99
R1575:St7 UTSW 6 17,886,110 (GRCm39) missense probably damaging 1.00
R2039:St7 UTSW 6 17,886,111 (GRCm39) missense probably damaging 1.00
R2144:St7 UTSW 6 17,886,006 (GRCm39) missense possibly damaging 0.58
R2194:St7 UTSW 6 17,942,718 (GRCm39) missense probably damaging 1.00
R2869:St7 UTSW 6 17,819,276 (GRCm39) missense probably damaging 1.00
R2869:St7 UTSW 6 17,819,276 (GRCm39) missense probably damaging 1.00
R2873:St7 UTSW 6 17,819,276 (GRCm39) missense probably damaging 1.00
R2874:St7 UTSW 6 17,819,276 (GRCm39) missense probably damaging 1.00
R2970:St7 UTSW 6 17,844,908 (GRCm39) missense probably damaging 1.00
R3076:St7 UTSW 6 17,846,237 (GRCm39) nonsense probably null
R3921:St7 UTSW 6 17,846,244 (GRCm39) missense probably benign 0.31
R4326:St7 UTSW 6 17,819,287 (GRCm39) missense probably damaging 1.00
R4327:St7 UTSW 6 17,819,287 (GRCm39) missense probably damaging 1.00
R4410:St7 UTSW 6 17,854,932 (GRCm39) nonsense probably null
R4732:St7 UTSW 6 17,906,515 (GRCm39) splice site probably null
R4733:St7 UTSW 6 17,906,515 (GRCm39) splice site probably null
R4868:St7 UTSW 6 17,819,265 (GRCm39) missense probably damaging 1.00
R4988:St7 UTSW 6 17,934,225 (GRCm39) missense probably damaging 0.99
R5182:St7 UTSW 6 17,846,236 (GRCm39) missense probably damaging 0.99
R5195:St7 UTSW 6 17,743,636 (GRCm39) intron probably benign
R5358:St7 UTSW 6 17,819,317 (GRCm39) missense probably damaging 1.00
R5502:St7 UTSW 6 17,834,673 (GRCm39) missense possibly damaging 0.94
R5882:St7 UTSW 6 17,846,248 (GRCm39) missense probably damaging 1.00
R5976:St7 UTSW 6 17,694,221 (GRCm39) missense possibly damaging 0.93
R6049:St7 UTSW 6 17,694,347 (GRCm39) missense possibly damaging 0.92
R6139:St7 UTSW 6 17,694,353 (GRCm39) missense probably damaging 1.00
R6177:St7 UTSW 6 17,819,333 (GRCm39) critical splice donor site probably null
R6181:St7 UTSW 6 17,694,363 (GRCm39) critical splice donor site probably null
R6401:St7 UTSW 6 17,855,317 (GRCm39) splice site probably null
R6546:St7 UTSW 6 17,852,313 (GRCm39) missense probably damaging 1.00
R6711:St7 UTSW 6 17,848,069 (GRCm39) missense possibly damaging 0.82
R6898:St7 UTSW 6 17,854,945 (GRCm39) missense probably damaging 1.00
R7536:St7 UTSW 6 17,886,019 (GRCm39) missense probably damaging 0.99
R7583:St7 UTSW 6 17,942,753 (GRCm39) missense possibly damaging 0.54
R7626:St7 UTSW 6 17,934,216 (GRCm39) missense probably damaging 1.00
R7718:St7 UTSW 6 17,854,998 (GRCm39) missense probably damaging 0.99
R7943:St7 UTSW 6 17,844,911 (GRCm39) missense probably damaging 1.00
R8334:St7 UTSW 6 17,934,220 (GRCm39) missense probably damaging 1.00
R8415:St7 UTSW 6 17,848,080 (GRCm39) critical splice donor site probably null
R9018:St7 UTSW 6 17,906,494 (GRCm39) missense probably damaging 1.00
R9217:St7 UTSW 6 17,846,271 (GRCm39) missense probably damaging 0.98
R9294:St7 UTSW 6 17,844,913 (GRCm39) nonsense probably null
Z1176:St7 UTSW 6 17,848,044 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGCACAAATGAGCCTCTGC -3'
(R):5'- AAGCTGGCTTAGGCACTTATG -3'

Sequencing Primer
(F):5'- AGTTTGCAAGTCCAATGGGCC -3'
(R):5'- GTGACTATGGTATTATCATGGCTCAG -3'
Posted On 2016-06-21