Incidental Mutation 'R5132:Magi1'
ID 395869
Institutional Source Beutler Lab
Gene Symbol Magi1
Ensembl Gene ENSMUSG00000045095
Gene Name membrane associated guanylate kinase, WW and PDZ domain containing 1
Synonyms Baiap1, Gukmi1, AIP3, BAP1, WWP3
MMRRC Submission 042720-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.561) question?
Stock # R5132 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 93652436-94260898 bp(-) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) C to A at 93660072 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055224] [ENSMUST00000089317] [ENSMUST00000093769] [ENSMUST00000203519] [ENSMUST00000203519] [ENSMUST00000203688] [ENSMUST00000204347] [ENSMUST00000204532]
AlphaFold Q6RHR9
Predicted Effect probably null
Transcript: ENSMUST00000055224
SMART Domains Protein: ENSMUSP00000062085
Gene: ENSMUSG00000045095

DomainStartEndE-ValueType
PDZ 26 105 8.04e-5 SMART
GuKc 111 295 2.55e-49 SMART
WW 301 333 9.65e-11 SMART
WW 348 380 2.88e-9 SMART
low complexity region 390 402 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
PDZ 460 536 3.71e-18 SMART
PDZ 631 703 4.68e-15 SMART
low complexity region 707 714 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
PDZ 800 876 4.64e-19 SMART
low complexity region 920 942 N/A INTRINSIC
PDB:1UEW|A 945 977 2e-6 PDB
PDZ 1043 1117 1.26e-20 SMART
low complexity region 1152 1164 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000089317
SMART Domains Protein: ENSMUSP00000086730
Gene: ENSMUSG00000045095

DomainStartEndE-ValueType
PDZ 26 105 4e-7 SMART
GuKc 111 295 1.3e-51 SMART
WW 301 333 5.8e-13 SMART
WW 360 392 1.7e-11 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 1.9e-20 SMART
PDZ 643 715 2.3e-17 SMART
low complexity region 733 746 N/A INTRINSIC
PDZ 841 917 2.4e-21 SMART
low complexity region 961 983 N/A INTRINSIC
PDZ 999 1074 6.1e-25 SMART
PDZ 1140 1214 6.1e-23 SMART
low complexity region 1347 1357 N/A INTRINSIC
low complexity region 1366 1423 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093769
SMART Domains Protein: ENSMUSP00000091283
Gene: ENSMUSG00000045095

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
WW 74 106 9.65e-11 SMART
WW 133 165 2.88e-9 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 3.71e-18 SMART
PDZ 416 488 4.68e-15 SMART
low complexity region 492 499 N/A INTRINSIC
low complexity region 505 518 N/A INTRINSIC
PDZ 613 689 4.64e-19 SMART
low complexity region 733 755 N/A INTRINSIC
PDZ 771 858 2.3e-23 SMART
PDZ 924 998 1.26e-20 SMART
low complexity region 1131 1141 N/A INTRINSIC
low complexity region 1150 1207 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203519
SMART Domains Protein: ENSMUSP00000145244
Gene: ENSMUSG00000045095

DomainStartEndE-ValueType
PDZ 26 105 8.04e-5 SMART
GuKc 111 295 2.55e-49 SMART
WW 301 333 9.65e-11 SMART
WW 360 392 2.88e-9 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 3.71e-18 SMART
PDZ 643 715 4.68e-15 SMART
low complexity region 719 726 N/A INTRINSIC
low complexity region 732 745 N/A INTRINSIC
PDZ 812 888 4.64e-19 SMART
low complexity region 932 954 N/A INTRINSIC
PDB:1UEW|A 957 989 2e-6 PDB
PDZ 1055 1115 1.13e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203519
SMART Domains Protein: ENSMUSP00000145244
Gene: ENSMUSG00000045095

DomainStartEndE-ValueType
PDZ 26 105 8.04e-5 SMART
GuKc 111 295 2.55e-49 SMART
WW 301 333 9.65e-11 SMART
WW 360 392 2.88e-9 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 3.71e-18 SMART
PDZ 643 715 4.68e-15 SMART
low complexity region 719 726 N/A INTRINSIC
low complexity region 732 745 N/A INTRINSIC
PDZ 812 888 4.64e-19 SMART
low complexity region 932 954 N/A INTRINSIC
PDB:1UEW|A 957 989 2e-6 PDB
PDZ 1055 1115 1.13e-8 SMART
Predicted Effect probably null
Transcript: ENSMUST00000203688
SMART Domains Protein: ENSMUSP00000145515
Gene: ENSMUSG00000045095

DomainStartEndE-ValueType
Pfam:MAGI_u1 1 34 2.9e-17 PFAM
WW 74 106 9.65e-11 SMART
WW 133 165 2.88e-9 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 3.71e-18 SMART
PDZ 416 488 4.68e-15 SMART
low complexity region 506 519 N/A INTRINSIC
PDZ 614 690 4.64e-19 SMART
low complexity region 734 756 N/A INTRINSIC
PDZ 772 858 1.74e-23 SMART
PDZ 924 998 1.26e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000204347
SMART Domains Protein: ENSMUSP00000144881
Gene: ENSMUSG00000045095

DomainStartEndE-ValueType
PDZ 26 105 4e-7 SMART
GuKc 111 295 1.3e-51 SMART
WW 301 333 5.8e-13 SMART
WW 360 392 1.7e-11 SMART
low complexity region 402 414 N/A INTRINSIC
low complexity region 422 440 N/A INTRINSIC
PDZ 472 548 1.9e-20 SMART
PDZ 643 715 2.3e-17 SMART
low complexity region 733 746 N/A INTRINSIC
PDZ 841 917 2.4e-21 SMART
low complexity region 961 983 N/A INTRINSIC
PDZ 999 1086 1.1e-25 SMART
PDZ 1152 1226 6.1e-23 SMART
low complexity region 1261 1273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204532
SMART Domains Protein: ENSMUSP00000144769
Gene: ENSMUSG00000045095

DomainStartEndE-ValueType
Pfam:MAGI_u1 1 34 1.8e-14 PFAM
WW 74 106 5.8e-13 SMART
WW 133 165 1.7e-11 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 195 213 N/A INTRINSIC
PDZ 245 321 1.9e-20 SMART
PDZ 416 488 7.3e-17 SMART
Meta Mutation Damage Score 0.9483 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the membrane-associated guanylate kinase homologue (MAGUK) family. MAGUK proteins participate in the assembly of multiprotein complexes on the inner surface of the plasma membrane at regions of cell-cell contact. The product of this gene may play a role as scaffolding protein at cell-cell junctions. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(165) : Targeted(2) Gene trapped(163)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 A T 1: 156,469,402 (GRCm39) K785* probably null Het
Acad11 A T 9: 104,003,791 (GRCm39) I628L probably benign Het
Ago1 T C 4: 126,355,516 (GRCm39) I98V probably benign Het
Bach2 A G 4: 32,563,396 (GRCm39) probably benign Het
Calr3 C T 8: 73,185,212 (GRCm39) probably null Het
Cdc23 C A 18: 34,784,742 (GRCm39) V7L unknown Het
Cdc42ep3 C T 17: 79,642,803 (GRCm39) R39H probably damaging Het
Cyp2j5 T C 4: 96,517,733 (GRCm39) Y493C probably damaging Het
Ddx19b A T 8: 111,749,040 (GRCm39) D66E probably benign Het
Drosha A G 15: 12,837,377 (GRCm39) D287G unknown Het
Gm8888 A G 15: 96,664,892 (GRCm39) noncoding transcript Het
Gpr25 G T 1: 136,188,103 (GRCm39) A170E probably damaging Het
Gria1 A G 11: 57,180,225 (GRCm39) Y656C probably damaging Het
Grik5 C T 7: 24,764,629 (GRCm39) V145I probably benign Het
Htt T C 5: 35,063,023 (GRCm39) V2885A possibly damaging Het
Larp6 A G 9: 60,644,493 (GRCm39) E211G probably damaging Het
Mtbp A G 15: 55,421,965 (GRCm39) S63G possibly damaging Het
Ndor1 A T 2: 25,137,781 (GRCm39) S513T probably benign Het
Nsd3 A G 8: 26,168,855 (GRCm39) D670G possibly damaging Het
Or10ag56 A T 2: 87,139,282 (GRCm39) M50L probably damaging Het
Or4k49 T A 2: 111,495,344 (GRCm39) Y258N probably damaging Het
Or5e1 T C 7: 108,354,477 (GRCm39) V138A probably damaging Het
Pcdh7 T C 5: 57,885,463 (GRCm39) V1061A probably benign Het
Pdia4 A G 6: 47,773,669 (GRCm39) I560T probably benign Het
Pomt2 A G 12: 87,157,121 (GRCm39) F733L probably damaging Het
Pprc1 T C 19: 46,061,121 (GRCm39) probably benign Het
Prkca T C 11: 108,082,943 (GRCm39) probably benign Het
Pspc1 A T 14: 56,960,707 (GRCm39) S473T probably benign Het
Rgs12 A G 5: 35,147,156 (GRCm39) probably benign Het
Scn3a C T 2: 65,298,548 (GRCm39) V1384I probably benign Het
Serpinb6a C T 13: 34,102,305 (GRCm39) D307N probably benign Het
Smap2 T C 4: 120,830,370 (GRCm39) E255G possibly damaging Het
Spmip6 A G 4: 41,517,178 (GRCm39) probably benign Het
St7 A T 6: 17,854,956 (GRCm39) I298F probably damaging Het
Tgm7 A G 2: 120,934,700 (GRCm39) F93L probably damaging Het
Timm23 A T 14: 31,915,902 (GRCm39) D56E probably damaging Het
Tmem170 A T 8: 112,596,357 (GRCm39) M56K probably benign Het
Other mutations in Magi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Magi1 APN 6 94,260,074 (GRCm39) missense possibly damaging 0.86
IGL01457:Magi1 APN 6 93,724,205 (GRCm39) missense probably damaging 0.99
IGL01642:Magi1 APN 6 93,663,605 (GRCm39) missense possibly damaging 0.69
IGL01724:Magi1 APN 6 93,769,381 (GRCm39) splice site probably null
IGL01967:Magi1 APN 6 93,685,115 (GRCm39) missense probably damaging 1.00
IGL01984:Magi1 APN 6 93,685,155 (GRCm39) missense probably damaging 1.00
IGL02074:Magi1 APN 6 93,722,579 (GRCm39) missense probably damaging 1.00
IGL02098:Magi1 APN 6 93,655,768 (GRCm39) missense probably damaging 1.00
IGL02225:Magi1 APN 6 93,671,007 (GRCm39) missense probably damaging 1.00
IGL02522:Magi1 APN 6 93,655,617 (GRCm39) missense possibly damaging 0.89
IGL02659:Magi1 APN 6 93,762,591 (GRCm39) missense possibly damaging 0.68
IGL02900:Magi1 APN 6 93,663,854 (GRCm39) missense probably damaging 1.00
P0007:Magi1 UTSW 6 93,722,969 (GRCm39) missense probably damaging 1.00
R0149:Magi1 UTSW 6 93,724,226 (GRCm39) missense probably damaging 1.00
R0512:Magi1 UTSW 6 93,671,045 (GRCm39) missense probably damaging 1.00
R1487:Magi1 UTSW 6 93,685,060 (GRCm39) missense probably benign 0.00
R1497:Magi1 UTSW 6 93,724,310 (GRCm39) missense probably damaging 1.00
R1502:Magi1 UTSW 6 93,671,151 (GRCm39) missense probably damaging 1.00
R1824:Magi1 UTSW 6 93,676,620 (GRCm39) missense possibly damaging 0.94
R2042:Magi1 UTSW 6 93,732,026 (GRCm39) missense probably benign
R2132:Magi1 UTSW 6 93,674,255 (GRCm39) missense probably damaging 0.99
R2331:Magi1 UTSW 6 93,662,543 (GRCm39) missense probably damaging 1.00
R2418:Magi1 UTSW 6 93,722,891 (GRCm39) missense probably damaging 1.00
R3076:Magi1 UTSW 6 93,734,668 (GRCm39) missense possibly damaging 0.63
R3551:Magi1 UTSW 6 93,676,610 (GRCm39) missense probably damaging 0.98
R4005:Magi1 UTSW 6 93,678,299 (GRCm39) missense probably damaging 1.00
R4455:Magi1 UTSW 6 93,762,438 (GRCm39) missense probably damaging 1.00
R4670:Magi1 UTSW 6 93,663,624 (GRCm39) splice site probably null
R4671:Magi1 UTSW 6 93,657,768 (GRCm39) critical splice donor site probably null
R4839:Magi1 UTSW 6 93,671,177 (GRCm39) missense probably damaging 1.00
R5147:Magi1 UTSW 6 93,724,248 (GRCm39) missense probably damaging 1.00
R5525:Magi1 UTSW 6 93,769,354 (GRCm39) missense possibly damaging 0.95
R5724:Magi1 UTSW 6 93,722,682 (GRCm39) missense probably damaging 1.00
R5724:Magi1 UTSW 6 93,657,852 (GRCm39) missense probably benign 0.03
R5846:Magi1 UTSW 6 93,662,584 (GRCm39) missense probably damaging 1.00
R5896:Magi1 UTSW 6 93,685,180 (GRCm39) missense probably damaging 1.00
R5912:Magi1 UTSW 6 93,685,126 (GRCm39) missense possibly damaging 0.95
R6112:Magi1 UTSW 6 93,722,571 (GRCm39) missense probably damaging 1.00
R6115:Magi1 UTSW 6 93,685,051 (GRCm39) missense possibly damaging 0.64
R6351:Magi1 UTSW 6 93,920,210 (GRCm39) missense possibly damaging 0.82
R6355:Magi1 UTSW 6 94,260,177 (GRCm39) missense probably benign 0.06
R6457:Magi1 UTSW 6 93,676,620 (GRCm39) missense probably damaging 1.00
R6464:Magi1 UTSW 6 93,676,770 (GRCm39) missense probably damaging 1.00
R6613:Magi1 UTSW 6 93,722,654 (GRCm39) missense probably damaging 1.00
R6661:Magi1 UTSW 6 93,920,289 (GRCm39) missense probably benign 0.08
R6755:Magi1 UTSW 6 93,685,158 (GRCm39) missense probably damaging 1.00
R6909:Magi1 UTSW 6 93,674,301 (GRCm39) missense probably damaging 1.00
R7180:Magi1 UTSW 6 93,792,731 (GRCm39) missense probably benign 0.10
R7224:Magi1 UTSW 6 93,660,070 (GRCm39) missense probably benign 0.34
R7447:Magi1 UTSW 6 93,722,562 (GRCm39) missense possibly damaging 0.63
R7517:Magi1 UTSW 6 93,685,189 (GRCm39) missense probably damaging 0.99
R7537:Magi1 UTSW 6 93,685,091 (GRCm39) nonsense probably null
R7549:Magi1 UTSW 6 93,685,095 (GRCm39) missense probably benign 0.19
R7566:Magi1 UTSW 6 93,655,308 (GRCm39) missense probably benign 0.03
R7805:Magi1 UTSW 6 93,659,927 (GRCm39) missense probably benign
R8022:Magi1 UTSW 6 93,674,346 (GRCm39) missense probably damaging 1.00
R8290:Magi1 UTSW 6 94,260,066 (GRCm39) missense probably damaging 1.00
R8519:Magi1 UTSW 6 93,681,330 (GRCm39) missense possibly damaging 0.83
R8762:Magi1 UTSW 6 93,792,789 (GRCm39) nonsense probably null
R8894:Magi1 UTSW 6 93,663,586 (GRCm39) missense probably benign 0.12
R8974:Magi1 UTSW 6 93,674,223 (GRCm39) missense probably damaging 1.00
R9225:Magi1 UTSW 6 93,762,511 (GRCm39) missense possibly damaging 0.64
R9277:Magi1 UTSW 6 93,920,234 (GRCm39) missense possibly damaging 0.48
R9300:Magi1 UTSW 6 93,724,209 (GRCm39) missense probably damaging 1.00
R9393:Magi1 UTSW 6 93,659,890 (GRCm39) missense probably benign 0.27
R9402:Magi1 UTSW 6 94,260,278 (GRCm39) missense probably benign 0.00
R9432:Magi1 UTSW 6 93,660,058 (GRCm39) missense probably damaging 1.00
R9567:Magi1 UTSW 6 93,659,931 (GRCm39) critical splice donor site probably null
R9567:Magi1 UTSW 6 93,655,431 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGAGACAAGCTCATGGAGTC -3'
(R):5'- GCTCACATTCTCCTGGTAGC -3'

Sequencing Primer
(F):5'- CATGGAGTCATGCCAGGG -3'
(R):5'- ACGTACTACTTGTATAGCATGCC -3'
Posted On 2016-06-21