Incidental Mutation 'R5132:Olfr513'
ID 395872
Institutional Source Beutler Lab
Gene Symbol Olfr513
Ensembl Gene ENSMUSG00000051200
Gene Name olfactory receptor 513
Synonyms MOR195-1, GA_x6K02T2PBJ9-11084889-11085818
MMRRC Submission 042720-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.236) question?
Stock # R5132 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 108750973-108756800 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108755270 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 138 (V138A)
Ref Sequence ENSEMBL: ENSMUSP00000149440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055146] [ENSMUST00000214670]
AlphaFold Q8VFZ3
Predicted Effect probably damaging
Transcript: ENSMUST00000055146
AA Change: V138A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050578
Gene: ENSMUSG00000051200
AA Change: V138A

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 2.7e-55 PFAM
Pfam:7TM_GPCR_Srsx 33 304 2.3e-6 PFAM
Pfam:7tm_1 39 289 2.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214670
AA Change: V138A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A G 4: 41,517,178 probably benign Het
Abl2 A T 1: 156,641,832 K785* probably null Het
Acad11 A T 9: 104,126,592 I628L probably benign Het
Ago1 T C 4: 126,461,723 I98V probably benign Het
Bach2 A G 4: 32,563,396 probably benign Het
Calr3 C T 8: 72,431,368 probably null Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdc42ep3 C T 17: 79,335,374 R39H probably damaging Het
Cyp2j5 T C 4: 96,629,496 Y493C probably damaging Het
Ddx19b A T 8: 111,022,408 D66E probably benign Het
Drosha A G 15: 12,837,291 D287G unknown Het
Gm8888 A G 15: 96,767,011 noncoding transcript Het
Gpr25 G T 1: 136,260,365 A170E probably damaging Het
Gria1 A G 11: 57,289,399 Y656C probably damaging Het
Grik5 C T 7: 25,065,204 V145I probably benign Het
Htt T C 5: 34,905,679 V2885A possibly damaging Het
Larp6 A G 9: 60,737,210 E211G probably damaging Het
Magi1 C A 6: 93,683,091 probably null Het
Mtbp A G 15: 55,558,569 S63G possibly damaging Het
Ndor1 A T 2: 25,247,769 S513T probably benign Het
Nsd3 A G 8: 25,678,839 D670G possibly damaging Het
Olfr1118 A T 2: 87,308,938 M50L probably damaging Het
Olfr1299 T A 2: 111,664,999 Y258N probably damaging Het
Pcdh7 T C 5: 57,728,121 V1061A probably benign Het
Pdia4 A G 6: 47,796,735 I560T probably benign Het
Pomt2 A G 12: 87,110,347 F733L probably damaging Het
Pprc1 T C 19: 46,072,682 probably benign Het
Prkca T C 11: 108,192,117 probably benign Het
Pspc1 A T 14: 56,723,250 S473T probably benign Het
Rgs12 A G 5: 34,989,812 probably benign Het
Scn3a C T 2: 65,468,204 V1384I probably benign Het
Serpinb6a C T 13: 33,918,322 D307N probably benign Het
Smap2 T C 4: 120,973,173 E255G possibly damaging Het
St7 A T 6: 17,854,957 I298F probably damaging Het
Tgm7 A G 2: 121,104,219 F93L probably damaging Het
Timm23 A T 14: 32,193,945 D56E probably damaging Het
Tmem170 A T 8: 111,869,725 M56K probably benign Het
Other mutations in Olfr513
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02491:Olfr513 APN 7 108755114 missense probably damaging 1.00
IGL03086:Olfr513 APN 7 108755796 utr 3 prime probably benign
FR4340:Olfr513 UTSW 7 108754954 small insertion probably benign
IGL02799:Olfr513 UTSW 7 108755623 missense probably benign
R0218:Olfr513 UTSW 7 108755574 nonsense probably null
R1103:Olfr513 UTSW 7 108754883 missense possibly damaging 0.92
R1251:Olfr513 UTSW 7 108754907 missense probably damaging 0.99
R1450:Olfr513 UTSW 7 108755512 missense probably damaging 1.00
R1582:Olfr513 UTSW 7 108755110 missense probably benign 0.04
R1608:Olfr513 UTSW 7 108755102 missense probably damaging 0.99
R1726:Olfr513 UTSW 7 108755008 missense probably benign 0.00
R1880:Olfr513 UTSW 7 108755128 missense probably damaging 1.00
R1881:Olfr513 UTSW 7 108755128 missense probably damaging 1.00
R2136:Olfr513 UTSW 7 108755223 missense possibly damaging 0.58
R2216:Olfr513 UTSW 7 108755612 missense probably damaging 1.00
R4006:Olfr513 UTSW 7 108755261 missense probably damaging 1.00
R4603:Olfr513 UTSW 7 108755627 missense probably damaging 1.00
R4881:Olfr513 UTSW 7 108755405 missense probably damaging 1.00
R5426:Olfr513 UTSW 7 108755717 missense possibly damaging 0.94
R5679:Olfr513 UTSW 7 108754996 missense probably damaging 0.97
R5848:Olfr513 UTSW 7 108755574 nonsense probably null
R5911:Olfr513 UTSW 7 108755675 missense probably benign 0.36
R6474:Olfr513 UTSW 7 108755029 missense probably damaging 1.00
R7016:Olfr513 UTSW 7 108755711 missense probably damaging 1.00
R7783:Olfr513 UTSW 7 108755569 missense probably damaging 1.00
R8113:Olfr513 UTSW 7 108755231 missense probably damaging 1.00
R8385:Olfr513 UTSW 7 108755304 nonsense probably null
R9429:Olfr513 UTSW 7 108755205 missense probably damaging 0.98
R9746:Olfr513 UTSW 7 108755432 missense probably benign
Z1088:Olfr513 UTSW 7 108755104 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GGCTTCACACGCCAATGTAC -3'
(R):5'- GATCAGAAGCTGCCTCTCTTTG -3'

Sequencing Primer
(F):5'- CTTCCATTGGGCCAAAAATGCTG -3'
(R):5'- CAGAAGCTGCCTCTCTTTGTTGTG -3'
Posted On 2016-06-21