Incidental Mutation 'R5132:Calr3'
ID395874
Institutional Source Beutler Lab
Gene Symbol Calr3
Ensembl Gene ENSMUSG00000019732
Gene Namecalreticulin 3
SynonymsCrt2, 6330586I20Rik, calsperin, 1700031L01Rik
MMRRC Submission 042720-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R5132 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location72424176-72443870 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 72431368 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019876] [ENSMUST00000109974]
Predicted Effect probably null
Transcript: ENSMUST00000019876
SMART Domains Protein: ENSMUSP00000019876
Gene: ENSMUSG00000019732

DomainStartEndE-ValueType
Pfam:Calreticulin 23 256 5.7e-40 PFAM
Pfam:Calreticulin 255 315 6.6e-7 PFAM
low complexity region 345 359 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109974
SMART Domains Protein: ENSMUSP00000105601
Gene: ENSMUSG00000019732

DomainStartEndE-ValueType
Pfam:Calreticulin 23 207 7.9e-32 PFAM
low complexity region 237 251 N/A INTRINSIC
low complexity region 257 268 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120752
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the calreticulin family, members of which are calcium-binding chaperones localized mainly in the endoplasmic reticulum. This protein is also localized to the endoplasmic reticulum lumen, however, its capacity for calcium-binding may be absent or much lower than other family members. This gene is specifically expressed in the testis, and may be required for sperm fertility. Mutation in this gene has been associated with familial hypertrophic cardiomyopathy. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility associated with impaired zona pellucida binding and fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A G 4: 41,517,178 probably benign Het
Abl2 A T 1: 156,641,832 K785* probably null Het
Acad11 A T 9: 104,126,592 I628L probably benign Het
Ago1 T C 4: 126,461,723 I98V probably benign Het
Bach2 A G 4: 32,563,396 probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdc42ep3 C T 17: 79,335,374 R39H probably damaging Het
Cyp2j5 T C 4: 96,629,496 Y493C probably damaging Het
Ddx19b A T 8: 111,022,408 D66E probably benign Het
Drosha A G 15: 12,837,291 D287G unknown Het
Gm8888 A G 15: 96,767,011 noncoding transcript Het
Gpr25 G T 1: 136,260,365 A170E probably damaging Het
Gria1 A G 11: 57,289,399 Y656C probably damaging Het
Grik5 C T 7: 25,065,204 V145I probably benign Het
Htt T C 5: 34,905,679 V2885A possibly damaging Het
Larp6 A G 9: 60,737,210 E211G probably damaging Het
Magi1 C A 6: 93,683,091 probably null Het
Mtbp A G 15: 55,558,569 S63G possibly damaging Het
Ndor1 A T 2: 25,247,769 S513T probably benign Het
Nsd3 A G 8: 25,678,839 D670G possibly damaging Het
Olfr1118 A T 2: 87,308,938 M50L probably damaging Het
Olfr1299 T A 2: 111,664,999 Y258N probably damaging Het
Olfr513 T C 7: 108,755,270 V138A probably damaging Het
Pcdh7 T C 5: 57,728,121 V1061A probably benign Het
Pdia4 A G 6: 47,796,735 I560T probably benign Het
Pomt2 A G 12: 87,110,347 F733L probably damaging Het
Pprc1 T C 19: 46,072,682 probably benign Het
Prkca T C 11: 108,192,117 probably benign Het
Pspc1 A T 14: 56,723,250 S473T probably benign Het
Rgs12 A G 5: 34,989,812 probably benign Het
Scn3a C T 2: 65,468,204 V1384I probably benign Het
Serpinb6a C T 13: 33,918,322 D307N probably benign Het
Smap2 T C 4: 120,973,173 E255G possibly damaging Het
St7 A T 6: 17,854,957 I298F probably damaging Het
Tgm7 A G 2: 121,104,219 F93L probably damaging Het
Timm23 A T 14: 32,193,945 D56E probably damaging Het
Tmem170 A T 8: 111,869,725 M56K probably benign Het
Other mutations in Calr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Calr3 APN 8 72431396 nonsense probably null
IGL01358:Calr3 APN 8 72427213 nonsense probably null
IGL02440:Calr3 APN 8 72431432 missense probably benign 0.30
IGL02646:Calr3 APN 8 72443460 missense possibly damaging 0.89
IGL02882:Calr3 APN 8 72434821 missense probably damaging 0.99
IGL02945:Calr3 APN 8 72438557 missense probably damaging 1.00
IGL03025:Calr3 APN 8 72434891 splice site probably benign
IGL03175:Calr3 APN 8 72443605 missense probably damaging 1.00
R0140:Calr3 UTSW 8 72434888 splice site probably benign
R1518:Calr3 UTSW 8 72427200 missense probably damaging 0.97
R1675:Calr3 UTSW 8 72431458 missense probably damaging 1.00
R2006:Calr3 UTSW 8 72434851 missense probably damaging 1.00
R2111:Calr3 UTSW 8 72427268 missense probably damaging 0.99
R2202:Calr3 UTSW 8 72434839 missense probably damaging 1.00
R2296:Calr3 UTSW 8 72424625 unclassified probably benign
R2432:Calr3 UTSW 8 72438426 unclassified probably benign
R3946:Calr3 UTSW 8 72443620 missense probably damaging 1.00
R4382:Calr3 UTSW 8 72428164 missense probably damaging 1.00
R4383:Calr3 UTSW 8 72428164 missense probably damaging 1.00
R4384:Calr3 UTSW 8 72428164 missense probably damaging 1.00
R4385:Calr3 UTSW 8 72428164 missense probably damaging 1.00
R4943:Calr3 UTSW 8 72431377 missense probably benign 0.18
R7337:Calr3 UTSW 8 72431495 missense probably damaging 1.00
R7879:Calr3 UTSW 8 72424643 missense unknown
R7962:Calr3 UTSW 8 72424643 missense unknown
Predicted Primers PCR Primer
(F):5'- TTGGAGCAGCAGTCAGGC -3'
(R):5'- CTACACCCTGATCTTAAGACCAG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGTGCTCAGAGGCAG -3'
(R):5'- AGACCAGATCTTTCTTACGAGG -3'
Posted On2016-06-21