Mutagenetix > Incidental Mutation

Incidental Mutation 'R5132:Pomt2'

395882

Institutional Source

Beutler Lab

Gene Symbol

Pomt2

Ensembl Gene

ENSMUSG00000034126

Gene Name

protein-O-mannosyltransferase 2

Synonyms

A830009D15Rik

MMRRC Submission

042720-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5132 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87106861-87147968 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87110347 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 733 (F733L)

Ref Sequence

ENSEMBL: ENSMUSP00000035260 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037788] [ENSMUST00000222634]

AlphaFold

Q8BGQ4

Predicted Effect

probably damaging
Transcript: ENSMUST00000037788
AA Change: F733L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000035260
Gene: ENSMUSG00000034126
AA Change: F733L

Domain	Start	End	E-Value	Type
low complexity region	4	24	N/A	INTRINSIC
Pfam:PMT	132	376	5.4e-91	PFAM
MIR	404	460	4.05e-9	SMART
MIR	473	529	5.52e-11	SMART
MIR	534	591	1.21e-7	SMART
Pfam:PMT_4TMC	608	818	5.9e-55	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000222634

Meta Mutation Damage Score

0.3302

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: This gene encodes an integral membrane protein that belongs to the dolichyl-phosphate-mannose-protein mannosyltransferase family. The encoded enzyme is found in the membrane of the endoplasmic reticulum. This protein is a component of the protein O-mannosyltransferase enzyme complex which is involved in modification of the protein alpha-dystroglycan. Mutations in the human gene are a cause of different forms of muscular dystrophy-dystroglycanopathy (MDDG), type A2 (also known as Walker-Warburg syndrome), type B2 and type C2 (also known as limb-girdle muscular dystrophy). [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for one knock-out allele die between E8.5 and E9.5 with abnormal Reichert's membrane and runting. Mice homozygous for another allele die before implantation and arrest at the morula stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	A	G	4: 41,517,178		probably benign	Het
Abl2	A	T	1: 156,641,832	K785*	probably null	Het
Acad11	A	T	9: 104,126,592	I628L	probably benign	Het
Ago1	T	C	4: 126,461,723	I98V	probably benign	Het
Bach2	A	G	4: 32,563,396		probably benign	Het
Calr3	C	T	8: 72,431,368		probably null	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Cdc42ep3	C	T	17: 79,335,374	R39H	probably damaging	Het
Cyp2j5	T	C	4: 96,629,496	Y493C	probably damaging	Het
Ddx19b	A	T	8: 111,022,408	D66E	probably benign	Het
Drosha	A	G	15: 12,837,291	D287G	unknown	Het
Gm8888	A	G	15: 96,767,011		noncoding transcript	Het
Gpr25	G	T	1: 136,260,365	A170E	probably damaging	Het
Gria1	A	G	11: 57,289,399	Y656C	probably damaging	Het
Grik5	C	T	7: 25,065,204	V145I	probably benign	Het
Htt	T	C	5: 34,905,679	V2885A	possibly damaging	Het
Larp6	A	G	9: 60,737,210	E211G	probably damaging	Het
Magi1	C	A	6: 93,683,091		probably null	Het
Mtbp	A	G	15: 55,558,569	S63G	possibly damaging	Het
Ndor1	A	T	2: 25,247,769	S513T	probably benign	Het
Nsd3	A	G	8: 25,678,839	D670G	possibly damaging	Het
Olfr1118	A	T	2: 87,308,938	M50L	probably damaging	Het
Olfr1299	T	A	2: 111,664,999	Y258N	probably damaging	Het
Olfr513	T	C	7: 108,755,270	V138A	probably damaging	Het
Pcdh7	T	C	5: 57,728,121	V1061A	probably benign	Het
Pdia4	A	G	6: 47,796,735	I560T	probably benign	Het
Pprc1	T	C	19: 46,072,682		probably benign	Het
Prkca	T	C	11: 108,192,117		probably benign	Het
Pspc1	A	T	14: 56,723,250	S473T	probably benign	Het
Rgs12	A	G	5: 34,989,812		probably benign	Het
Scn3a	C	T	2: 65,468,204	V1384I	probably benign	Het
Serpinb6a	C	T	13: 33,918,322	D307N	probably benign	Het
Smap2	T	C	4: 120,973,173	E255G	possibly damaging	Het
St7	A	T	6: 17,854,957	I298F	probably damaging	Het
Tgm7	A	G	2: 121,104,219	F93L	probably damaging	Het
Timm23	A	T	14: 32,193,945	D56E	probably damaging	Het
Tmem170	A	T	8: 111,869,725	M56K	probably benign	Het

Other mutations in Pomt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00495:Pomt2	APN	12	87124856	missense	probably damaging	1.00
IGL00508:Pomt2	APN	12	87119627	missense	probably damaging	1.00
IGL01069:Pomt2	APN	12	87110304	missense	probably damaging	1.00
IGL01688:Pomt2	APN	12	87147520	missense	probably benign
IGL01887:Pomt2	APN	12	87119589	missense	probably damaging	1.00
IGL02120:Pomt2	APN	12	87111552	missense	probably benign	0.07
IGL02233:Pomt2	APN	12	87111411	missense	probably benign	0.00
IGL02305:Pomt2	APN	12	87117929	splice site	probably benign
IGL02372:Pomt2	APN	12	87122835	splice site	probably benign
IGL02516:Pomt2	APN	12	87119646	missense	probably benign	0.00
IGL02616:Pomt2	APN	12	87124862	missense	probably damaging	1.00
IGL03039:Pomt2	APN	12	87110366	missense	probably benign	0.03
IGL03385:Pomt2	APN	12	87116556	missense	probably damaging	1.00
PIT4366001:Pomt2	UTSW	12	87116529	critical splice donor site	probably null
R1055:Pomt2	UTSW	12	87147480	missense	possibly damaging	0.49
R1716:Pomt2	UTSW	12	87124836	missense	probably benign	0.03
R1880:Pomt2	UTSW	12	87135596	missense	probably damaging	1.00
R1881:Pomt2	UTSW	12	87135596	missense	probably damaging	1.00
R2011:Pomt2	UTSW	12	87111399	missense	possibly damaging	0.95
R2443:Pomt2	UTSW	12	87133380	missense	probably damaging	1.00
R2913:Pomt2	UTSW	12	87128969	missense	probably damaging	0.98
R4036:Pomt2	UTSW	12	87111522	critical splice donor site	probably null
R4482:Pomt2	UTSW	12	87131830	missense	probably benign	0.41
R4647:Pomt2	UTSW	12	87118083	missense	possibly damaging	0.49
R4758:Pomt2	UTSW	12	87122878	missense	probably damaging	1.00
R4872:Pomt2	UTSW	12	87110107	missense	possibly damaging	0.89
R5071:Pomt2	UTSW	12	87133460	missense	probably damaging	0.96
R5074:Pomt2	UTSW	12	87133460	missense	probably damaging	0.96
R5514:Pomt2	UTSW	12	87129023	missense	probably damaging	1.00
R5790:Pomt2	UTSW	12	87127378	missense	probably damaging	1.00
R6128:Pomt2	UTSW	12	87111335	critical splice donor site	probably null
R6370:Pomt2	UTSW	12	87109199	missense	probably damaging	1.00
R6631:Pomt2	UTSW	12	87139643	critical splice donor site	probably null
R6979:Pomt2	UTSW	12	87130351	missense	probably damaging	1.00
R7057:Pomt2	UTSW	12	87127378	missense	probably damaging	0.96
R7114:Pomt2	UTSW	12	87110376	missense	probably damaging	1.00
R7690:Pomt2	UTSW	12	87130367	missense	probably damaging	1.00
R7864:Pomt2	UTSW	12	87122882	missense	probably benign	0.00
R8060:Pomt2	UTSW	12	87129006	missense	probably damaging	1.00
R8695:Pomt2	UTSW	12	87110016	missense	probably benign	0.12
R8851:Pomt2	UTSW	12	87138064	missense	probably damaging	0.99
R9176:Pomt2	UTSW	12	87147677	intron	probably benign
R9407:Pomt2	UTSW	12	87110372	missense	probably damaging	1.00
R9509:Pomt2	UTSW	12	87138028	missense	possibly damaging	0.48
X0026:Pomt2	UTSW	12	87111375	missense	possibly damaging	0.93
Z1177:Pomt2	UTSW	12	87111442	missense	possibly damaging	0.74
Z1177:Pomt2	UTSW	12	87139681	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTACCAGCCTATCAGGACAG -3'
(R):5'- TCTTTCTAGTCGCCATGGGG -3'

Sequencing Primer
(F):5'- AGCACCTGGGGATCCTACAG -3'
(R):5'- GTGACATGTTCAGAGTCACATACC -3'

Posted On

2016-06-21