Incidental Mutation 'R5132:Pspc1'
ID 395884
Institutional Source Beutler Lab
Gene Symbol Pspc1
Ensembl Gene ENSMUSG00000021938
Gene Name paraspeckle protein 1
Synonyms 5730470C09Rik, PSP1
MMRRC Submission 042720-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5132 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 56720710-56778316 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 56723250 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 473 (S473T)
Ref Sequence ENSEMBL: ENSMUSP00000022507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022507] [ENSMUST00000163924]
AlphaFold Q8R326
Predicted Effect probably benign
Transcript: ENSMUST00000022507
AA Change: S473T

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022507
Gene: ENSMUSG00000021938
AA Change: S473T

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
RRM 82 149 8.91e-21 SMART
RRM 156 232 1.51e-9 SMART
low complexity region 298 310 N/A INTRINSIC
low complexity region 320 344 N/A INTRINSIC
low complexity region 350 376 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
low complexity region 433 452 N/A INTRINSIC
low complexity region 494 516 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163924
SMART Domains Protein: ENSMUSP00000133038
Gene: ENSMUSG00000021938

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
RRM 82 149 8.91e-21 SMART
RRM 156 232 1.51e-9 SMART
low complexity region 298 310 N/A INTRINSIC
low complexity region 320 344 N/A INTRINSIC
low complexity region 350 376 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
low complexity region 433 452 N/A INTRINSIC
Meta Mutation Damage Score 0.0691 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein that localizes to punctate subnuclear structures that occur close to splicing speckles, known as paraspeckles. These paraspeckles are composed of RNA-protein structures that include a non-coding RNA, NEAT1/Men epsilon/beta, and the Drosophila Behavior Human Splicing family of proteins, which include the product of this gene and the P54NRB/NONO and PSF/SFPQ proteins. Paraspeckles may function in the control of gene expression via an RNA nuclear retention mechanism. The protein encoded by this gene is found in paraspeckles in transcriptionally active cells, but it localizes to unique cap structures at the nucleolar periphery when RNA polymerase II transcription is inhibited, or during telophase. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene, which is also located on chromosome 13, has been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trap allele do not display any gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A G 4: 41,517,178 probably benign Het
Abl2 A T 1: 156,641,832 K785* probably null Het
Acad11 A T 9: 104,126,592 I628L probably benign Het
Ago1 T C 4: 126,461,723 I98V probably benign Het
Bach2 A G 4: 32,563,396 probably benign Het
Calr3 C T 8: 72,431,368 probably null Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdc42ep3 C T 17: 79,335,374 R39H probably damaging Het
Cyp2j5 T C 4: 96,629,496 Y493C probably damaging Het
Ddx19b A T 8: 111,022,408 D66E probably benign Het
Drosha A G 15: 12,837,291 D287G unknown Het
Gm8888 A G 15: 96,767,011 noncoding transcript Het
Gpr25 G T 1: 136,260,365 A170E probably damaging Het
Gria1 A G 11: 57,289,399 Y656C probably damaging Het
Grik5 C T 7: 25,065,204 V145I probably benign Het
Htt T C 5: 34,905,679 V2885A possibly damaging Het
Larp6 A G 9: 60,737,210 E211G probably damaging Het
Magi1 C A 6: 93,683,091 probably null Het
Mtbp A G 15: 55,558,569 S63G possibly damaging Het
Ndor1 A T 2: 25,247,769 S513T probably benign Het
Nsd3 A G 8: 25,678,839 D670G possibly damaging Het
Olfr1118 A T 2: 87,308,938 M50L probably damaging Het
Olfr1299 T A 2: 111,664,999 Y258N probably damaging Het
Olfr513 T C 7: 108,755,270 V138A probably damaging Het
Pcdh7 T C 5: 57,728,121 V1061A probably benign Het
Pdia4 A G 6: 47,796,735 I560T probably benign Het
Pomt2 A G 12: 87,110,347 F733L probably damaging Het
Pprc1 T C 19: 46,072,682 probably benign Het
Prkca T C 11: 108,192,117 probably benign Het
Rgs12 A G 5: 34,989,812 probably benign Het
Scn3a C T 2: 65,468,204 V1384I probably benign Het
Serpinb6a C T 13: 33,918,322 D307N probably benign Het
Smap2 T C 4: 120,973,173 E255G possibly damaging Het
St7 A T 6: 17,854,957 I298F probably damaging Het
Tgm7 A G 2: 121,104,219 F93L probably damaging Het
Timm23 A T 14: 32,193,945 D56E probably damaging Het
Tmem170 A T 8: 111,869,725 M56K probably benign Het
Other mutations in Pspc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Pspc1 APN 14 56771711 missense probably damaging 1.00
IGL02281:Pspc1 APN 14 56723178 missense probably benign
IGL02954:Pspc1 APN 14 56771760 missense probably benign 0.17
IGL02989:Pspc1 APN 14 56771696 intron probably benign
Erudite UTSW 14 56761848 missense probably damaging 0.96
perspicacious UTSW 14 56771847 nonsense probably null
R1549:Pspc1 UTSW 14 56748941 missense probably damaging 1.00
R1696:Pspc1 UTSW 14 56764243 missense probably benign 0.02
R4574:Pspc1 UTSW 14 56761947 missense possibly damaging 0.91
R4599:Pspc1 UTSW 14 56777789 critical splice donor site probably null
R5243:Pspc1 UTSW 14 56764191 missense probably damaging 1.00
R5519:Pspc1 UTSW 14 56771956 missense probably benign 0.11
R5610:Pspc1 UTSW 14 56777931 missense probably damaging 1.00
R5724:Pspc1 UTSW 14 56778072 missense probably benign 0.01
R5867:Pspc1 UTSW 14 56762041 splice site probably null
R5968:Pspc1 UTSW 14 56764236 missense probably benign 0.14
R6544:Pspc1 UTSW 14 56764203 makesense probably null
R7034:Pspc1 UTSW 14 56758628 critical splice donor site probably null
R7036:Pspc1 UTSW 14 56758628 critical splice donor site probably null
R7961:Pspc1 UTSW 14 56771847 nonsense probably null
R8009:Pspc1 UTSW 14 56771847 nonsense probably null
R8184:Pspc1 UTSW 14 56764243 missense probably benign 0.02
R8221:Pspc1 UTSW 14 56778159 start codon destroyed probably benign 0.01
R9166:Pspc1 UTSW 14 56761848 missense probably damaging 0.96
X0065:Pspc1 UTSW 14 56725415 missense possibly damaging 0.79
Z1177:Pspc1 UTSW 14 56748875 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGACATGGTGTAAAGACATACCATTG -3'
(R):5'- TGGCATAAGGAGGCATTTGC -3'

Sequencing Primer
(F):5'- TTTCTAAACAGTCAGGAATGAACC -3'
(R):5'- CATAAGGAGGCATTTGCTTATGTCAG -3'
Posted On 2016-06-21