Incidental Mutation 'R5132:Cdc42ep3'
ID 395888
Institutional Source Beutler Lab
Gene Symbol Cdc42ep3
Ensembl Gene ENSMUSG00000036533
Gene Name CDC42 effector protein (Rho GTPase binding) 3
Synonyms Cep3, UB1, 3200001F04Rik, Borg2
MMRRC Submission 042720-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5132 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 79334025-79355091 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 79335374 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 39 (R39H)
Ref Sequence ENSEMBL: ENSMUSP00000067217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068958]
AlphaFold Q9CQC5
Predicted Effect probably damaging
Transcript: ENSMUST00000068958
AA Change: R39H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067217
Gene: ENSMUSG00000036533
AA Change: R39H

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
PBD 31 67 2.98e-7 SMART
Pfam:BORG_CEP 102 253 4.8e-36 PFAM
Meta Mutation Damage Score 0.9530 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a small family of guanosine triphosphate (GTP) metabolizing proteins that contain a CRIB (Cdc42, Rac interactive binding) domain. Members of this family of proteins act as effectors of CDC42 function. The encoded protein is involved in actin cytoskeleton re-organization during cell shape changes, including pseudopodia formation. A pseudogene of this gene is found on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A G 4: 41,517,178 probably benign Het
Abl2 A T 1: 156,641,832 K785* probably null Het
Acad11 A T 9: 104,126,592 I628L probably benign Het
Ago1 T C 4: 126,461,723 I98V probably benign Het
Bach2 A G 4: 32,563,396 probably benign Het
Calr3 C T 8: 72,431,368 probably null Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cyp2j5 T C 4: 96,629,496 Y493C probably damaging Het
Ddx19b A T 8: 111,022,408 D66E probably benign Het
Drosha A G 15: 12,837,291 D287G unknown Het
Gm8888 A G 15: 96,767,011 noncoding transcript Het
Gpr25 G T 1: 136,260,365 A170E probably damaging Het
Gria1 A G 11: 57,289,399 Y656C probably damaging Het
Grik5 C T 7: 25,065,204 V145I probably benign Het
Htt T C 5: 34,905,679 V2885A possibly damaging Het
Larp6 A G 9: 60,737,210 E211G probably damaging Het
Magi1 C A 6: 93,683,091 probably null Het
Mtbp A G 15: 55,558,569 S63G possibly damaging Het
Ndor1 A T 2: 25,247,769 S513T probably benign Het
Nsd3 A G 8: 25,678,839 D670G possibly damaging Het
Olfr1118 A T 2: 87,308,938 M50L probably damaging Het
Olfr1299 T A 2: 111,664,999 Y258N probably damaging Het
Olfr513 T C 7: 108,755,270 V138A probably damaging Het
Pcdh7 T C 5: 57,728,121 V1061A probably benign Het
Pdia4 A G 6: 47,796,735 I560T probably benign Het
Pomt2 A G 12: 87,110,347 F733L probably damaging Het
Pprc1 T C 19: 46,072,682 probably benign Het
Prkca T C 11: 108,192,117 probably benign Het
Pspc1 A T 14: 56,723,250 S473T probably benign Het
Rgs12 A G 5: 34,989,812 probably benign Het
Scn3a C T 2: 65,468,204 V1384I probably benign Het
Serpinb6a C T 13: 33,918,322 D307N probably benign Het
Smap2 T C 4: 120,973,173 E255G possibly damaging Het
St7 A T 6: 17,854,957 I298F probably damaging Het
Tgm7 A G 2: 121,104,219 F93L probably damaging Het
Timm23 A T 14: 32,193,945 D56E probably damaging Het
Tmem170 A T 8: 111,869,725 M56K probably benign Het
Other mutations in Cdc42ep3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Cdc42ep3 APN 17 79335455 missense possibly damaging 0.80
R1428:Cdc42ep3 UTSW 17 79335036 missense probably benign 0.06
R1531:Cdc42ep3 UTSW 17 79335044 missense probably benign 0.08
R4378:Cdc42ep3 UTSW 17 79334979 missense probably benign 0.00
R4715:Cdc42ep3 UTSW 17 79335458 missense probably benign 0.11
R7057:Cdc42ep3 UTSW 17 79335523 start gained probably benign
R9150:Cdc42ep3 UTSW 17 79334870 missense probably benign 0.04
Z1177:Cdc42ep3 UTSW 17 79334878 missense probably benign
Z1177:Cdc42ep3 UTSW 17 79334898 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATAAGGGCAGCATCAGAGCC -3'
(R):5'- TAGGATACCCGTGCAGAAGG -3'

Sequencing Primer
(F):5'- AGATGGCATTTTTGAGCACCG -3'
(R):5'- GATACCCGTGCAGAAGGTCACTC -3'
Posted On 2016-06-21