Incidental Mutation 'R5133:Oprl1'
ID395909
Institutional Source Beutler Lab
Gene Symbol Oprl1
Ensembl Gene ENSMUSG00000027584
Gene Nameopioid receptor-like 1
SynonymsORL1, morc, N/OFQ receptor, MOR-C, nociceptin/ orphaninFQ receptor, LC132, XOR1
MMRRC Submission 042721-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.440) question?
Stock #R5133 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location181715016-181720985 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 181718610 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 153 (I153N)
Ref Sequence ENSEMBL: ENSMUSP00000104399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071585] [ENSMUST00000108763] [ENSMUST00000108766] [ENSMUST00000108767] [ENSMUST00000108768] [ENSMUST00000148334] [ENSMUST00000183693] [ENSMUST00000184127] [ENSMUST00000184795]
Predicted Effect probably damaging
Transcript: ENSMUST00000071585
AA Change: I153N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071513
Gene: ENSMUSG00000027584
AA Change: I153N

DomainStartEndE-ValueType
Pfam:7tm_4 54 334 5.8e-9 PFAM
Pfam:7TM_GPCR_Srx 56 264 1.4e-6 PFAM
Pfam:7TM_GPCR_Srsx 59 331 1.2e-14 PFAM
Pfam:7tm_1 65 316 1.4e-62 PFAM
Pfam:7TM_GPCR_Srv 112 332 7.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108763
AA Change: I139N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104394
Gene: ENSMUSG00000027584
AA Change: I139N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 317 6.9e-11 PFAM
Pfam:7tm_1 60 302 1.6e-62 PFAM
Pfam:7TM_GPCR_Srv 91 318 4.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108766
AA Change: I153N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104397
Gene: ENSMUSG00000027584
AA Change: I153N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 56 189 3.6e-8 PFAM
Pfam:7TM_GPCR_Srsx 59 201 1.8e-9 PFAM
Pfam:7tm_1 65 210 1.6e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108767
AA Change: I153N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104398
Gene: ENSMUSG00000027584
AA Change: I153N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 331 1.2e-14 PFAM
Pfam:7tm_1 65 316 2.1e-66 PFAM
Pfam:7TM_GPCR_Srv 105 332 7.6e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108768
AA Change: I153N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104399
Gene: ENSMUSG00000027584
AA Change: I153N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 331 1.2e-14 PFAM
Pfam:7tm_1 65 316 2.1e-66 PFAM
Pfam:7TM_GPCR_Srv 105 332 7.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126835
Predicted Effect probably benign
Transcript: ENSMUST00000148334
SMART Domains Protein: ENSMUSP00000118664
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
Pfam:7tm_1 65 140 5.9e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151241
Predicted Effect probably benign
Transcript: ENSMUST00000183693
SMART Domains Protein: ENSMUSP00000138810
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
SCOP:d1l9ha_ 21 77 1e-3 SMART
PDB:4EA3|B 41 76 9e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000184127
SMART Domains Protein: ENSMUSP00000139119
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
SCOP:d1l9ha_ 21 76 3e-4 SMART
PDB:4EA3|B 41 76 1e-16 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000184795
SMART Domains Protein: ENSMUSP00000138979
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
SCOP:d1l9ha_ 21 71 2e-3 SMART
PDB:4EA3|B 41 71 5e-13 PDB
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the 7 transmembrane-spanning G protein-coupled receptor family, and functions as a receptor for the endogenous, opioid-related neuropeptide, nociceptin/orphanin FQ. This receptor-ligand system modulates a variety of biological functions and neurobehavior, including stress responses and anxiety behavior, learning and memory, locomotor activity, and inflammatory and immune responses. Alternatively spliced transcript variants have been described for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit altered touch/nociception, facilitation of long-term potentiation and memory, increased dopamine release upon administration of opioid peptide agonist, impaired behavioral response to morphine, and increased susceptibility to noise-induced hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik C T 18: 57,563,969 T65I possibly damaging Het
A3galt2 A T 4: 128,762,141 T101S probably damaging Het
Abraxas2 C T 7: 132,883,146 A306V probably benign Het
Acvr1c T A 2: 58,283,506 N248I probably damaging Het
Adgrv1 C T 13: 81,439,441 R4537Q probably damaging Het
Adrb3 A C 8: 27,227,770 M217R probably damaging Het
Afg3l1 T C 8: 123,489,793 V257A probably benign Het
Agbl1 C A 7: 76,422,156 Q334K probably benign Het
Aox4 A T 1: 58,236,676 D389V probably benign Het
Apob A T 12: 8,008,898 Q2427L probably damaging Het
Asxl3 T C 18: 22,516,708 C585R probably damaging Het
Baz2a G A 10: 128,116,126 G571D probably damaging Het
Baz2b A T 2: 59,962,024 S587T probably benign Het
Bicdl2 T C 17: 23,661,821 L14P unknown Het
Cachd1 G A 4: 100,994,738 S1177N probably damaging Het
Cacna2d3 A G 14: 29,293,178 F86L possibly damaging Het
Cd3d A T 9: 44,984,998 E28D probably damaging Het
Cmya5 T C 13: 93,093,372 K1736R possibly damaging Het
Col12a1 A G 9: 79,605,174 V2913A probably damaging Het
Cops8 A G 1: 90,611,002 D51G probably damaging Het
Csgalnact1 T C 8: 68,460,971 E194G probably benign Het
Csn1s1 A G 5: 87,680,878 D267G possibly damaging Het
Cyp2c40 T C 19: 39,807,219 N172S probably benign Het
Dhtkd1 T A 2: 5,904,002 K760N probably damaging Het
Dnah17 T C 11: 118,117,113 K691E probably benign Het
Dppa4 G A 16: 48,292,971 R189Q probably benign Het
Dsp G A 13: 38,197,702 D2808N possibly damaging Het
Egr2 A G 10: 67,539,775 E17G probably damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Epas1 A G 17: 86,809,454 N184S probably damaging Het
Ezh2 C T 6: 47,540,750 C584Y probably damaging Het
F10 T C 8: 13,055,698 V421A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam186a T G 15: 99,955,493 D122A unknown Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam234b T C 6: 135,209,195 V67A probably benign Het
Fbn2 T C 18: 58,039,340 D2131G probably damaging Het
Fgfr4 T C 13: 55,160,015 Y271H probably damaging Het
Gm960 T A 19: 4,658,421 S194C probably damaging Het
Gnmt A T 17: 46,725,934 S250T probably benign Het
Golgb1 C A 16: 36,891,457 Q208K possibly damaging Het
Grn C A 11: 102,430,554 probably benign Het
Grwd1 T C 7: 45,825,874 T415A probably benign Het
Gsk3b G A 16: 38,240,520 R418H probably damaging Het
Hap1 T G 11: 100,351,531 M382L probably benign Het
Hspa12b A G 2: 131,139,508 E221G possibly damaging Het
Hspa4l T A 3: 40,786,747 D709E possibly damaging Het
Il17ra A G 6: 120,481,553 E555G possibly damaging Het
Il27ra T C 8: 84,034,059 T426A possibly damaging Het
Jup T C 11: 100,383,115 D200G probably benign Het
Kcnq1 T C 7: 143,194,346 probably null Het
Kctd9 C T 14: 67,729,356 T106I probably damaging Het
Kmt5b T A 19: 3,802,240 H159Q probably damaging Het
Kprp C T 3: 92,824,522 R407Q unknown Het
Kras T C 6: 145,232,153 Q131R probably benign Het
Krt16 T A 11: 100,247,631 R230S probably damaging Het
Lpar6 G A 14: 73,238,707 C36Y probably damaging Het
Lrp10 T C 14: 54,469,610 S635P probably benign Het
Mapre2 C A 18: 23,858,133 H153N possibly damaging Het
Mark3 C A 12: 111,655,328 R703S probably damaging Het
Mboat2 A G 12: 24,959,066 D457G probably benign Het
Med13 T C 11: 86,319,849 D489G probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mtus1 T C 8: 41,083,192 T496A probably benign Het
Mum1 T C 10: 80,232,868 L282P probably benign Het
Nckap5 T C 1: 126,033,960 H204R probably benign Het
Nlrc4 G T 17: 74,446,717 P224T possibly damaging Het
Olfr1221 A T 2: 89,111,796 probably null Het
Olfr1434 T C 19: 12,283,306 L86P possibly damaging Het
Olfr1480 T A 19: 13,530,078 M135K probably damaging Het
Olfr60 A T 7: 140,345,323 I222N probably damaging Het
Otud4 G A 8: 79,655,689 V176I probably damaging Het
Pcdhb5 T C 18: 37,320,890 F108L probably benign Het
Pde8b T C 13: 95,086,742 I335V probably benign Het
Pdzd7 T A 19: 45,028,429 I886L possibly damaging Het
Prune2 C T 19: 17,003,631 P51S probably damaging Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Rab27b T C 18: 69,989,588 D100G probably damaging Het
Rpf1 A G 3: 146,506,538 L349S probably damaging Het
Samd14 T C 11: 95,021,583 S233P probably damaging Het
Sema6a C A 18: 47,300,128 V79F probably damaging Het
Setbp1 A G 18: 78,857,482 I990T probably damaging Het
Setx A G 2: 29,180,081 R2633G probably benign Het
Siae T G 9: 37,646,520 I541S possibly damaging Het
Slc13a1 A G 6: 24,103,429 S372P possibly damaging Het
Smarcc2 T C 10: 128,461,473 probably null Het
Snrpf T C 10: 93,588,123 S2G probably benign Het
Speer2 C A 16: 69,858,820 K39N probably null Het
Spink5 T G 18: 43,986,423 F267C probably damaging Het
Tgfbrap1 G T 1: 43,075,506 R145S probably damaging Het
Tmem161b C A 13: 84,294,768 T269K possibly damaging Het
Tmem64 T C 4: 15,281,119 I304T probably damaging Het
Tomm7 A G 5: 23,844,006 I23T probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttr C T 18: 20,670,110 A111V possibly damaging Het
Usp47 T A 7: 112,083,882 Y561N probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdr45b A G 11: 121,328,795 I309T probably benign Het
Wnt6 T C 1: 74,784,596 L364P probably damaging Het
Zc3h13 T C 14: 75,336,009 L1530P probably damaging Het
Zfp933 A G 4: 147,826,864 W60R probably benign Het
Other mutations in Oprl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02977:Oprl1 APN 2 181718511 missense probably damaging 1.00
R0302:Oprl1 UTSW 2 181719228 missense probably benign 0.01
R0453:Oprl1 UTSW 2 181718734 critical splice donor site probably null
R1564:Oprl1 UTSW 2 181718940 missense possibly damaging 0.79
R1618:Oprl1 UTSW 2 181718853 missense probably benign 0.22
R4801:Oprl1 UTSW 2 181719253 missense probably benign
R4802:Oprl1 UTSW 2 181719253 missense probably benign
R5032:Oprl1 UTSW 2 181719002 missense probably damaging 1.00
R5134:Oprl1 UTSW 2 181718610 missense probably damaging 0.99
R6284:Oprl1 UTSW 2 181717991 intron probably benign
R6374:Oprl1 UTSW 2 181715928 missense probably damaging 1.00
R6394:Oprl1 UTSW 2 181719002 missense probably damaging 1.00
R6843:Oprl1 UTSW 2 181715754 missense probably damaging 1.00
R7009:Oprl1 UTSW 2 181718381 missense probably damaging 1.00
X0022:Oprl1 UTSW 2 181715807 missense probably benign 0.28
X0024:Oprl1 UTSW 2 181718548 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGTCCTCTACAGGCACAC -3'
(R):5'- AACCATGGGGAACTGATTGG -3'

Sequencing Primer
(F):5'- AATCTGGCACTGGCTGATAC -3'
(R):5'- CTGATTGGTCAGGGAGGAGGAC -3'
Posted On2016-06-21