Mutagenetix > Incidental Mutation

Incidental Mutation 'R5133:Ezh2'

395922

Institutional Source

Beutler Lab

Gene Symbol

Ezh2

Ensembl Gene

ENSMUSG00000029687

Gene Name

enhancer of zeste 2 polycomb repressive complex 2 subunit

Synonyms

Enx-1, KMT6, Enx1h

MMRRC Submission

042721-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5133 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

47530139-47595341 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 47540750 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 584 (C584Y)

Ref Sequence

ENSEMBL: ENSMUSP00000110265 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081721] [ENSMUST00000092648] [ENSMUST00000114616] [ENSMUST00000114618]

AlphaFold

Q61188

Predicted Effect

probably damaging
Transcript: ENSMUST00000081721
AA Change: C588Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080419
Gene: ENSMUSG00000029687
AA Change: C588Y

Domain	Start	End	E-Value	Type
Pfam:EZH2_WD-Binding	39	68	6.1e-18	PFAM
SANT	159	250	9.7e-3	SMART
low complexity region	349	366	N/A	INTRINSIC
low complexity region	385	409	N/A	INTRINSIC
SANT	428	476	6.62e-1	SMART
CXC	555	592	1.05e-1	SMART
SET	612	733	4.15e-38	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000092648
AA Change: C546Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090318
Gene: ENSMUSG00000029687
AA Change: C546Y

Domain	Start	End	E-Value	Type
Pfam:EZH2_WD-Binding	39	68	6.9e-20	PFAM
SANT	159	250	9.7e-3	SMART
Blast:SET	272	333	3e-13	BLAST
low complexity region	349	366	N/A	INTRINSIC
low complexity region	385	409	N/A	INTRINSIC
SANT	428	476	6.62e-1	SMART
CXC	513	550	1.05e-1	SMART
SET	570	691	4.15e-38	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114616
AA Change: C549Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110263
Gene: ENSMUSG00000029687
AA Change: C549Y

Domain	Start	End	E-Value	Type
Pfam:EZH2_WD-Binding	39	68	2.5e-20	PFAM
SANT	120	211	9.7e-3	SMART
low complexity region	310	327	N/A	INTRINSIC
low complexity region	346	370	N/A	INTRINSIC
SANT	389	437	6.62e-1	SMART
CXC	516	553	1.05e-1	SMART
SET	573	694	4.15e-38	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114618
AA Change: C584Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110265
Gene: ENSMUSG00000029687
AA Change: C584Y

Domain	Start	End	E-Value	Type
Pfam:EZH2_WD-Binding	39	68	7.4e-20	PFAM
SANT	150	241	9.7e-3	SMART
low complexity region	345	362	N/A	INTRINSIC
low complexity region	381	405	N/A	INTRINSIC
SANT	424	472	6.62e-1	SMART
CXC	551	588	1.05e-1	SMART
SET	608	729	4.15e-38	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000164006

SMART Domains

Protein: ENSMUSP00000133195
Gene: ENSMUSG00000029687

Domain	Start	End	E-Value	Type
Blast:SET	2	96	1e-16	BLAST
low complexity region	98	122	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165492

Predicted Effect

probably benign
Transcript: ENSMUST00000167278

SMART Domains

Protein: ENSMUSP00000128542
Gene: ENSMUSG00000029687

Domain	Start	End	E-Value	Type
Blast:SET	2	43	6e-9	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170311

Predicted Effect

probably benign
Transcript: ENSMUST00000204243

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants die prior to completing gastrulation. A conditional mutant with loss of expression in immune cells survives, but has defects in early B cell development and Igh rearrangement. Conditional loss of maternal protein results in severegrowth retardation of neonates. Conditional loss in oligodendrocytes affects oligodendrocyte maturation and delays subsequent myelinization of axons in the central nervous system by oligodendrocytes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011I03Rik	C	T	18: 57,563,969	T65I	possibly damaging	Het
A3galt2	A	T	4: 128,762,141	T101S	probably damaging	Het
Abraxas2	C	T	7: 132,883,146	A306V	probably benign	Het
Acvr1c	T	A	2: 58,283,506	N248I	probably damaging	Het
Adgrv1	C	T	13: 81,439,441	R4537Q	probably damaging	Het
Adrb3	A	C	8: 27,227,770	M217R	probably damaging	Het
Afg3l1	T	C	8: 123,489,793	V257A	probably benign	Het
Agbl1	C	A	7: 76,422,156	Q334K	probably benign	Het
Aox4	A	T	1: 58,236,676	D389V	probably benign	Het
Apob	A	T	12: 8,008,898	Q2427L	probably damaging	Het
Asxl3	T	C	18: 22,516,708	C585R	probably damaging	Het
Baz2a	G	A	10: 128,116,126	G571D	probably damaging	Het
Baz2b	A	T	2: 59,962,024	S587T	probably benign	Het
Bicdl2	T	C	17: 23,661,821	L14P	unknown	Het
Cachd1	G	A	4: 100,994,738	S1177N	probably damaging	Het
Cacna2d3	A	G	14: 29,293,178	F86L	possibly damaging	Het
Cd3d	A	T	9: 44,984,998	E28D	probably damaging	Het
Cmya5	T	C	13: 93,093,372	K1736R	possibly damaging	Het
Col12a1	A	G	9: 79,605,174	V2913A	probably damaging	Het
Cops8	A	G	1: 90,611,002	D51G	probably damaging	Het
Csgalnact1	T	C	8: 68,460,971	E194G	probably benign	Het
Csn1s1	A	G	5: 87,680,878	D267G	possibly damaging	Het
Cyp2c40	T	C	19: 39,807,219	N172S	probably benign	Het
Dhtkd1	T	A	2: 5,904,002	K760N	probably damaging	Het
Dnah17	T	C	11: 118,117,113	K691E	probably benign	Het
Dppa4	G	A	16: 48,292,971	R189Q	probably benign	Het
Dsp	G	A	13: 38,197,702	D2808N	possibly damaging	Het
Egr2	A	G	10: 67,539,775	E17G	probably damaging	Het
Ehmt1	G	T	2: 24,877,497	P135T	probably damaging	Het
Epas1	A	G	17: 86,809,454	N184S	probably damaging	Het
F10	T	C	8: 13,055,698	V421A	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam186a	T	G	15: 99,955,493	D122A	unknown	Het
Fam227b	G	A	2: 126,116,123	P241S	probably damaging	Het
Fam234b	T	C	6: 135,209,195	V67A	probably benign	Het
Fbn2	T	C	18: 58,039,340	D2131G	probably damaging	Het
Fgfr4	T	C	13: 55,160,015	Y271H	probably damaging	Het
Gm960	T	A	19: 4,658,421	S194C	probably damaging	Het
Gnmt	A	T	17: 46,725,934	S250T	probably benign	Het
Golgb1	C	A	16: 36,891,457	Q208K	possibly damaging	Het
Grn	C	A	11: 102,430,554		probably benign	Het
Grwd1	T	C	7: 45,825,874	T415A	probably benign	Het
Gsk3b	G	A	16: 38,240,520	R418H	probably damaging	Het
Hap1	T	G	11: 100,351,531	M382L	probably benign	Het
Hspa12b	A	G	2: 131,139,508	E221G	possibly damaging	Het
Hspa4l	T	A	3: 40,786,747	D709E	possibly damaging	Het
Il17ra	A	G	6: 120,481,553	E555G	possibly damaging	Het
Il27ra	T	C	8: 84,034,059	T426A	possibly damaging	Het
Jup	T	C	11: 100,383,115	D200G	probably benign	Het
Kcnq1	T	C	7: 143,194,346		probably null	Het
Kctd9	C	T	14: 67,729,356	T106I	probably damaging	Het
Kmt5b	T	A	19: 3,802,240	H159Q	probably damaging	Het
Kprp	C	T	3: 92,824,522	R407Q	unknown	Het
Kras	T	C	6: 145,232,153	Q131R	probably benign	Het
Krt16	T	A	11: 100,247,631	R230S	probably damaging	Het
Lpar6	G	A	14: 73,238,707	C36Y	probably damaging	Het
Lrp10	T	C	14: 54,469,610	S635P	probably benign	Het
Mapre2	C	A	18: 23,858,133	H153N	possibly damaging	Het
Mark3	C	A	12: 111,655,328	R703S	probably damaging	Het
Mboat2	A	G	12: 24,959,066	D457G	probably benign	Het
Med13	T	C	11: 86,319,849	D489G	probably benign	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Mtus1	T	C	8: 41,083,192	T496A	probably benign	Het
Mum1	T	C	10: 80,232,868	L282P	probably benign	Het
Nckap5	T	C	1: 126,033,960	H204R	probably benign	Het
Nlrc4	G	T	17: 74,446,717	P224T	possibly damaging	Het
Olfr1221	A	T	2: 89,111,796		probably null	Het
Olfr1434	T	C	19: 12,283,306	L86P	possibly damaging	Het
Olfr1480	T	A	19: 13,530,078	M135K	probably damaging	Het
Olfr60	A	T	7: 140,345,323	I222N	probably damaging	Het
Oprl1	T	A	2: 181,718,610	I153N	probably damaging	Het
Otud4	G	A	8: 79,655,689	V176I	probably damaging	Het
Pcdhb5	T	C	18: 37,320,890	F108L	probably benign	Het
Pde8b	T	C	13: 95,086,742	I335V	probably benign	Het
Pdzd7	T	A	19: 45,028,429	I886L	possibly damaging	Het
Prune2	C	T	19: 17,003,631	P51S	probably damaging	Het
Ptpre	C	T	7: 135,669,132	H346Y	probably benign	Het
Rab27b	T	C	18: 69,989,588	D100G	probably damaging	Het
Rpf1	A	G	3: 146,506,538	L349S	probably damaging	Het
Samd14	T	C	11: 95,021,583	S233P	probably damaging	Het
Sema6a	C	A	18: 47,300,128	V79F	probably damaging	Het
Setbp1	A	G	18: 78,857,482	I990T	probably damaging	Het
Setx	A	G	2: 29,180,081	R2633G	probably benign	Het
Siae	T	G	9: 37,646,520	I541S	possibly damaging	Het
Slc13a1	A	G	6: 24,103,429	S372P	possibly damaging	Het
Smarcc2	T	C	10: 128,461,473		probably null	Het
Snrpf	T	C	10: 93,588,123	S2G	probably benign	Het
Speer2	C	A	16: 69,858,820	K39N	probably null	Het
Spink5	T	G	18: 43,986,423	F267C	probably damaging	Het
Tgfbrap1	G	T	1: 43,075,506	R145S	probably damaging	Het
Tmem161b	C	A	13: 84,294,768	T269K	possibly damaging	Het
Tmem64	T	C	4: 15,281,119	I304T	probably damaging	Het
Tomm7	A	G	5: 23,844,006	I23T	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ttr	C	T	18: 20,670,110	A111V	possibly damaging	Het
Usp47	T	A	7: 112,083,882	Y561N	probably damaging	Het
Vmn1r17	A	G	6: 57,360,843	V130A	probably benign	Het
Wdr45b	A	G	11: 121,328,795	I309T	probably benign	Het
Wnt6	T	C	1: 74,784,596	L364P	probably damaging	Het
Zc3h13	T	C	14: 75,336,009	L1530P	probably damaging	Het
Zfp933	A	G	4: 147,826,864	W60R	probably benign	Het

Other mutations in Ezh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01582:Ezh2	APN	6	47556055	nonsense	probably null
IGL01932:Ezh2	APN	6	47532048	missense	probably damaging	0.99
IGL02019:Ezh2	APN	6	47551901	splice site	probably null
IGL02748:Ezh2	APN	6	47558239	missense	probably damaging	1.00
IGL02749:Ezh2	APN	6	47533764	missense	probably damaging	0.99
IGL03171:Ezh2	APN	6	47540781	nonsense	probably null
Peezy	UTSW	6	47533758	nonsense	probably null
R0417:Ezh2	UTSW	6	47551726	missense	probably benign	0.00
R1256:Ezh2	UTSW	6	47541855	nonsense	probably null
R1587:Ezh2	UTSW	6	47552490	critical splice acceptor site	probably null
R1631:Ezh2	UTSW	6	47577658	start codon destroyed	probably null	0.01
R1736:Ezh2	UTSW	6	47576660	missense	probably damaging	1.00
R1775:Ezh2	UTSW	6	47576660	missense	probably damaging	1.00
R2076:Ezh2	UTSW	6	47576633	nonsense	probably null
R2311:Ezh2	UTSW	6	47558260	missense	probably damaging	1.00
R3751:Ezh2	UTSW	6	47556064	missense	possibly damaging	0.94
R4016:Ezh2	UTSW	6	47544582	missense	probably benign
R4119:Ezh2	UTSW	6	47544548	missense	probably benign	0.00
R4214:Ezh2	UTSW	6	47533814	missense	probably damaging	1.00
R4770:Ezh2	UTSW	6	47540696	missense	probably damaging	1.00
R5137:Ezh2	UTSW	6	47532080	splice site	probably null
R5199:Ezh2	UTSW	6	47551725	missense	probably benign	0.01
R5343:Ezh2	UTSW	6	47576615	missense	probably damaging	1.00
R5584:Ezh2	UTSW	6	47532016	missense	probably damaging	1.00
R5942:Ezh2	UTSW	6	47577582	missense	possibly damaging	0.94
R6057:Ezh2	UTSW	6	47552423	missense	probably damaging	1.00
R7247:Ezh2	UTSW	6	47533774	missense	probably damaging	1.00
R7284:Ezh2	UTSW	6	47544519	missense	probably benign	0.00
R7365:Ezh2	UTSW	6	47533758	nonsense	probably null
R7382:Ezh2	UTSW	6	47551836	missense	possibly damaging	0.55
R7718:Ezh2	UTSW	6	47554191	missense	probably benign
R7910:Ezh2	UTSW	6	47556143	missense	probably damaging	0.96
R8206:Ezh2	UTSW	6	47532900	critical splice donor site	probably null
R8428:Ezh2	UTSW	6	47545811	nonsense	probably null
R8746:Ezh2	UTSW	6	47576600	missense	probably damaging	0.99
R8836:Ezh2	UTSW	6	47554262	missense	probably benign
R8925:Ezh2	UTSW	6	47533779	missense	possibly damaging	0.89
R8927:Ezh2	UTSW	6	47533779	missense	possibly damaging	0.89
R9039:Ezh2	UTSW	6	47551737	missense	possibly damaging	0.80
R9171:Ezh2	UTSW	6	47554200	missense	probably benign
R9642:Ezh2	UTSW	6	47544519	missense	probably benign	0.00
R9716:Ezh2	UTSW	6	47554207	missense	possibly damaging	0.95
R9774:Ezh2	UTSW	6	47542381	missense	probably benign	0.00
X0021:Ezh2	UTSW	6	47554169	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCATCACGCACATTTAAGAGTCAC -3'
(R):5'- ACTGCCTTCCTGGAAAGGATG -3'

Sequencing Primer
(F):5'- AAGCCCTGGGTTTACTCCACAG -3'
(R):5'- CCTTCCTGGAAAGGATGTGGATG -3'

Posted On

2016-06-21