Incidental Mutation 'R5133:Il17ra'
ID 395924
Institutional Source Beutler Lab
Gene Symbol Il17ra
Ensembl Gene ENSMUSG00000002897
Gene Name interleukin 17 receptor A
Synonyms VDw217, Il17r
MMRRC Submission 042721-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock # R5133 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 120463247-120487559 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120481553 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 555 (E555G)
Ref Sequence ENSEMBL: ENSMUSP00000002976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002976]
AlphaFold Q60943
Predicted Effect possibly damaging
Transcript: ENSMUST00000002976
AA Change: E555G

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000002976
Gene: ENSMUSG00000002897
AA Change: E555G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:IL17R_fnIII_D1 48 198 1.3e-70 PFAM
Pfam:IL17R_fnIII_D2 199 303 9.6e-53 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:SEFIR 380 539 1.5e-51 PFAM
low complexity region 747 765 N/A INTRINSIC
low complexity region 801 830 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204078
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204239
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interleukin 17A (IL17A) is a proinflammatory cytokine secreted by activated T-lymphocytes. It is a potent inducer of the maturation of CD34-positive hematopoietic precursors into neutrophils. The transmembrane protein encoded by this gene (interleukin 17A receptor; IL17RA) is a ubiquitous type I membrane glycoprotein that binds with low affinity to interleukin 17A. Interleukin 17A and its receptor play a pathogenic role in many inflammatory and autoimmune diseases such as rheumatoid arthritis. Like other cytokine receptors, this receptor likely has a multimeric structure. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed neutrophil recruitment and enhanced susceptibility to intranasal infection by Klibsiella pneumoniae. Mice homozygous for a different knock-out allele exhibit delayed and milder IMQ-induced psoriasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik C T 18: 57,563,969 T65I possibly damaging Het
A3galt2 A T 4: 128,762,141 T101S probably damaging Het
Abraxas2 C T 7: 132,883,146 A306V probably benign Het
Acvr1c T A 2: 58,283,506 N248I probably damaging Het
Adgrv1 C T 13: 81,439,441 R4537Q probably damaging Het
Adrb3 A C 8: 27,227,770 M217R probably damaging Het
Afg3l1 T C 8: 123,489,793 V257A probably benign Het
Agbl1 C A 7: 76,422,156 Q334K probably benign Het
Aox4 A T 1: 58,236,676 D389V probably benign Het
Apob A T 12: 8,008,898 Q2427L probably damaging Het
Asxl3 T C 18: 22,516,708 C585R probably damaging Het
Baz2a G A 10: 128,116,126 G571D probably damaging Het
Baz2b A T 2: 59,962,024 S587T probably benign Het
Bicdl2 T C 17: 23,661,821 L14P unknown Het
Cachd1 G A 4: 100,994,738 S1177N probably damaging Het
Cacna2d3 A G 14: 29,293,178 F86L possibly damaging Het
Cd3d A T 9: 44,984,998 E28D probably damaging Het
Cmya5 T C 13: 93,093,372 K1736R possibly damaging Het
Col12a1 A G 9: 79,605,174 V2913A probably damaging Het
Cops8 A G 1: 90,611,002 D51G probably damaging Het
Csgalnact1 T C 8: 68,460,971 E194G probably benign Het
Csn1s1 A G 5: 87,680,878 D267G possibly damaging Het
Cyp2c40 T C 19: 39,807,219 N172S probably benign Het
Dhtkd1 T A 2: 5,904,002 K760N probably damaging Het
Dnah17 T C 11: 118,117,113 K691E probably benign Het
Dppa4 G A 16: 48,292,971 R189Q probably benign Het
Dsp G A 13: 38,197,702 D2808N possibly damaging Het
Egr2 A G 10: 67,539,775 E17G probably damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Epas1 A G 17: 86,809,454 N184S probably damaging Het
Ezh2 C T 6: 47,540,750 C584Y probably damaging Het
F10 T C 8: 13,055,698 V421A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam186a T G 15: 99,955,493 D122A unknown Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam234b T C 6: 135,209,195 V67A probably benign Het
Fbn2 T C 18: 58,039,340 D2131G probably damaging Het
Fgfr4 T C 13: 55,160,015 Y271H probably damaging Het
Gm960 T A 19: 4,658,421 S194C probably damaging Het
Gnmt A T 17: 46,725,934 S250T probably benign Het
Golgb1 C A 16: 36,891,457 Q208K possibly damaging Het
Grn C A 11: 102,430,554 probably benign Het
Grwd1 T C 7: 45,825,874 T415A probably benign Het
Gsk3b G A 16: 38,240,520 R418H probably damaging Het
Hap1 T G 11: 100,351,531 M382L probably benign Het
Hspa12b A G 2: 131,139,508 E221G possibly damaging Het
Hspa4l T A 3: 40,786,747 D709E possibly damaging Het
Il27ra T C 8: 84,034,059 T426A possibly damaging Het
Jup T C 11: 100,383,115 D200G probably benign Het
Kcnq1 T C 7: 143,194,346 probably null Het
Kctd9 C T 14: 67,729,356 T106I probably damaging Het
Kmt5b T A 19: 3,802,240 H159Q probably damaging Het
Kprp C T 3: 92,824,522 R407Q unknown Het
Kras T C 6: 145,232,153 Q131R probably benign Het
Krt16 T A 11: 100,247,631 R230S probably damaging Het
Lpar6 G A 14: 73,238,707 C36Y probably damaging Het
Lrp10 T C 14: 54,469,610 S635P probably benign Het
Mapre2 C A 18: 23,858,133 H153N possibly damaging Het
Mark3 C A 12: 111,655,328 R703S probably damaging Het
Mboat2 A G 12: 24,959,066 D457G probably benign Het
Med13 T C 11: 86,319,849 D489G probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mtus1 T C 8: 41,083,192 T496A probably benign Het
Mum1 T C 10: 80,232,868 L282P probably benign Het
Nckap5 T C 1: 126,033,960 H204R probably benign Het
Nlrc4 G T 17: 74,446,717 P224T possibly damaging Het
Olfr1221 A T 2: 89,111,796 probably null Het
Olfr1434 T C 19: 12,283,306 L86P possibly damaging Het
Olfr1480 T A 19: 13,530,078 M135K probably damaging Het
Olfr60 A T 7: 140,345,323 I222N probably damaging Het
Oprl1 T A 2: 181,718,610 I153N probably damaging Het
Otud4 G A 8: 79,655,689 V176I probably damaging Het
Pcdhb5 T C 18: 37,320,890 F108L probably benign Het
Pde8b T C 13: 95,086,742 I335V probably benign Het
Pdzd7 T A 19: 45,028,429 I886L possibly damaging Het
Prune2 C T 19: 17,003,631 P51S probably damaging Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Rab27b T C 18: 69,989,588 D100G probably damaging Het
Rpf1 A G 3: 146,506,538 L349S probably damaging Het
Samd14 T C 11: 95,021,583 S233P probably damaging Het
Sema6a C A 18: 47,300,128 V79F probably damaging Het
Setbp1 A G 18: 78,857,482 I990T probably damaging Het
Setx A G 2: 29,180,081 R2633G probably benign Het
Siae T G 9: 37,646,520 I541S possibly damaging Het
Slc13a1 A G 6: 24,103,429 S372P possibly damaging Het
Smarcc2 T C 10: 128,461,473 probably null Het
Snrpf T C 10: 93,588,123 S2G probably benign Het
Speer2 C A 16: 69,858,820 K39N probably null Het
Spink5 T G 18: 43,986,423 F267C probably damaging Het
Tgfbrap1 G T 1: 43,075,506 R145S probably damaging Het
Tmem161b C A 13: 84,294,768 T269K possibly damaging Het
Tmem64 T C 4: 15,281,119 I304T probably damaging Het
Tomm7 A G 5: 23,844,006 I23T probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttr C T 18: 20,670,110 A111V possibly damaging Het
Usp47 T A 7: 112,083,882 Y561N probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdr45b A G 11: 121,328,795 I309T probably benign Het
Wnt6 T C 1: 74,784,596 L364P probably damaging Het
Zc3h13 T C 14: 75,336,009 L1530P probably damaging Het
Zfp933 A G 4: 147,826,864 W60R probably benign Het
Other mutations in Il17ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Il17ra APN 6 120481465 missense probably damaging 1.00
IGL01413:Il17ra APN 6 120475581 missense probably benign 0.00
IGL01418:Il17ra APN 6 120475581 missense probably benign 0.00
IGL03215:Il17ra APN 6 120472114 missense probably damaging 1.00
IGL03047:Il17ra UTSW 6 120481226 missense probably damaging 1.00
PIT4305001:Il17ra UTSW 6 120481406 missense probably damaging 1.00
R0042:Il17ra UTSW 6 120472125 splice site probably benign
R0042:Il17ra UTSW 6 120472125 splice site probably benign
R0365:Il17ra UTSW 6 120478449 missense probably benign 0.03
R0391:Il17ra UTSW 6 120476979 splice site probably benign
R0470:Il17ra UTSW 6 120481806 missense probably benign 0.01
R0599:Il17ra UTSW 6 120481505 missense probably damaging 1.00
R1525:Il17ra UTSW 6 120473790 missense probably damaging 0.98
R1900:Il17ra UTSW 6 120477394 critical splice acceptor site probably null
R1972:Il17ra UTSW 6 120482216 missense probably benign 0.01
R4192:Il17ra UTSW 6 120481511 missense probably damaging 1.00
R4923:Il17ra UTSW 6 120477445 missense possibly damaging 0.94
R5009:Il17ra UTSW 6 120482207 missense probably benign 0.00
R5411:Il17ra UTSW 6 120481442 missense probably damaging 1.00
R5548:Il17ra UTSW 6 120478473 missense probably benign 0.23
R6137:Il17ra UTSW 6 120475582 missense probably benign 0.23
R6190:Il17ra UTSW 6 120475273 missense probably damaging 1.00
R7202:Il17ra UTSW 6 120475611 missense probably benign 0.01
R7300:Il17ra UTSW 6 120482102 missense probably benign 0.00
R8130:Il17ra UTSW 6 120478455 missense probably benign 0.01
R8152:Il17ra UTSW 6 120482102 missense probably benign 0.00
R8213:Il17ra UTSW 6 120473034 missense probably benign 0.39
R8525:Il17ra UTSW 6 120474337 nonsense probably null
R8560:Il17ra UTSW 6 120482265 missense possibly damaging 0.78
R8675:Il17ra UTSW 6 120481988 missense probably benign 0.05
R8754:Il17ra UTSW 6 120481456 missense probably benign 0.09
R8956:Il17ra UTSW 6 120481504 missense probably damaging 1.00
R9419:Il17ra UTSW 6 120481294 missense possibly damaging 0.63
R9478:Il17ra UTSW 6 120474375 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TTTTCACTGCAGCCATGAACATG -3'
(R):5'- CAGCAGTGGGTCTTCAAACAC -3'

Sequencing Primer
(F):5'- TGATCCTGCCAGACTTCAAGAGG -3'
(R):5'- CTTCTTCATCCAGGGAGGGAAGATC -3'
Posted On 2016-06-21