Mutagenetix > Incidental Mutations

Incidental Mutation 'R5133:Il17ra'

395924

Institutional Source

Beutler Lab

Gene Symbol

Il17ra

Ensembl Gene

ENSMUSG00000002897

Gene Name

interleukin 17 receptor A

Synonyms

VDw217, Il17r

MMRRC Submission

042721-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R5133 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120463247-120487559 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 120481553 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 555 (E555G)

Ref Sequence

ENSEMBL: ENSMUSP00000002976 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002976]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000002976
AA Change: E555G

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000002976
Gene: ENSMUSG00000002897
AA Change: E555G

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Pfam:IL17R_fnIII_D1	48	198	1.3e-70	PFAM
Pfam:IL17R_fnIII_D2	199	303	9.6e-53	PFAM
transmembrane domain	321	343	N/A	INTRINSIC
Pfam:SEFIR	380	539	1.5e-51	PFAM
low complexity region	747	765	N/A	INTRINSIC
low complexity region	801	830	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204078

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204239

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interleukin 17A (IL17A) is a proinflammatory cytokine secreted by activated T-lymphocytes. It is a potent inducer of the maturation of CD34-positive hematopoietic precursors into neutrophils. The transmembrane protein encoded by this gene (interleukin 17A receptor; IL17RA) is a ubiquitous type I membrane glycoprotein that binds with low affinity to interleukin 17A. Interleukin 17A and its receptor play a pathogenic role in many inflammatory and autoimmune diseases such as rheumatoid arthritis. Like other cytokine receptors, this receptor likely has a multimeric structure. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed neutrophil recruitment and enhanced susceptibility to intranasal infection by Klibsiella pneumoniae. Mice homozygous for a different knock-out allele exhibit delayed and milder IMQ-induced psoriasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011I03Rik	C	T	18: 57,563,969	T65I	possibly damaging	Het
A3galt2	A	T	4: 128,762,141	T101S	probably damaging	Het
Abraxas2	C	T	7: 132,883,146	A306V	probably benign	Het
Acvr1c	T	A	2: 58,283,506	N248I	probably damaging	Het
Adgrv1	C	T	13: 81,439,441	R4537Q	probably damaging	Het
Adrb3	A	C	8: 27,227,770	M217R	probably damaging	Het
Afg3l1	T	C	8: 123,489,793	V257A	probably benign	Het
Agbl1	C	A	7: 76,422,156	Q334K	probably benign	Het
Aox4	A	T	1: 58,236,676	D389V	probably benign	Het
Apob	A	T	12: 8,008,898	Q2427L	probably damaging	Het
Asxl3	T	C	18: 22,516,708	C585R	probably damaging	Het
Baz2a	G	A	10: 128,116,126	G571D	probably damaging	Het
Baz2b	A	T	2: 59,962,024	S587T	probably benign	Het
Bicdl2	T	C	17: 23,661,821	L14P	unknown	Het
Cachd1	G	A	4: 100,994,738	S1177N	probably damaging	Het
Cacna2d3	A	G	14: 29,293,178	F86L	possibly damaging	Het
Cd3d	A	T	9: 44,984,998	E28D	probably damaging	Het
Cmya5	T	C	13: 93,093,372	K1736R	possibly damaging	Het
Col12a1	A	G	9: 79,605,174	V2913A	probably damaging	Het
Cops8	A	G	1: 90,611,002	D51G	probably damaging	Het
Csgalnact1	T	C	8: 68,460,971	E194G	probably benign	Het
Csn1s1	A	G	5: 87,680,878	D267G	possibly damaging	Het
Cyp2c40	T	C	19: 39,807,219	N172S	probably benign	Het
Dhtkd1	T	A	2: 5,904,002	K760N	probably damaging	Het
Dnah17	T	C	11: 118,117,113	K691E	probably benign	Het
Dppa4	G	A	16: 48,292,971	R189Q	probably benign	Het
Dsp	G	A	13: 38,197,702	D2808N	possibly damaging	Het
Egr2	A	G	10: 67,539,775	E17G	probably damaging	Het
Ehmt1	G	T	2: 24,877,497	P135T	probably damaging	Het
Epas1	A	G	17: 86,809,454	N184S	probably damaging	Het
Ezh2	C	T	6: 47,540,750	C584Y	probably damaging	Het
F10	T	C	8: 13,055,698	V421A	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam186a	T	G	15: 99,955,493	D122A	unknown	Het
Fam227b	G	A	2: 126,116,123	P241S	probably damaging	Het
Fam234b	T	C	6: 135,209,195	V67A	probably benign	Het
Fbn2	T	C	18: 58,039,340	D2131G	probably damaging	Het
Fgfr4	T	C	13: 55,160,015	Y271H	probably damaging	Het
Gm960	T	A	19: 4,658,421	S194C	probably damaging	Het
Gnmt	A	T	17: 46,725,934	S250T	probably benign	Het
Golgb1	C	A	16: 36,891,457	Q208K	possibly damaging	Het
Grn	C	A	11: 102,430,554		probably benign	Het
Grwd1	T	C	7: 45,825,874	T415A	probably benign	Het
Gsk3b	G	A	16: 38,240,520	R418H	probably damaging	Het
Hap1	T	G	11: 100,351,531	M382L	probably benign	Het
Hspa12b	A	G	2: 131,139,508	E221G	possibly damaging	Het
Hspa4l	T	A	3: 40,786,747	D709E	possibly damaging	Het
Il27ra	T	C	8: 84,034,059	T426A	possibly damaging	Het
Jup	T	C	11: 100,383,115	D200G	probably benign	Het
Kcnq1	T	C	7: 143,194,346		probably null	Het
Kctd9	C	T	14: 67,729,356	T106I	probably damaging	Het
Kmt5b	T	A	19: 3,802,240	H159Q	probably damaging	Het
Kprp	C	T	3: 92,824,522	R407Q	unknown	Het
Kras	T	C	6: 145,232,153	Q131R	probably benign	Het
Krt16	T	A	11: 100,247,631	R230S	probably damaging	Het
Lpar6	G	A	14: 73,238,707	C36Y	probably damaging	Het
Lrp10	T	C	14: 54,469,610	S635P	probably benign	Het
Mapre2	C	A	18: 23,858,133	H153N	possibly damaging	Het
Mark3	C	A	12: 111,655,328	R703S	probably damaging	Het
Mboat2	A	G	12: 24,959,066	D457G	probably benign	Het
Med13	T	C	11: 86,319,849	D489G	probably benign	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Mtus1	T	C	8: 41,083,192	T496A	probably benign	Het
Mum1	T	C	10: 80,232,868	L282P	probably benign	Het
Nckap5	T	C	1: 126,033,960	H204R	probably benign	Het
Nlrc4	G	T	17: 74,446,717	P224T	possibly damaging	Het
Olfr1221	A	T	2: 89,111,796		probably null	Het
Olfr1434	T	C	19: 12,283,306	L86P	possibly damaging	Het
Olfr1480	T	A	19: 13,530,078	M135K	probably damaging	Het
Olfr60	A	T	7: 140,345,323	I222N	probably damaging	Het
Oprl1	T	A	2: 181,718,610	I153N	probably damaging	Het
Otud4	G	A	8: 79,655,689	V176I	probably damaging	Het
Pcdhb5	T	C	18: 37,320,890	F108L	probably benign	Het
Pde8b	T	C	13: 95,086,742	I335V	probably benign	Het
Pdzd7	T	A	19: 45,028,429	I886L	possibly damaging	Het
Prune2	C	T	19: 17,003,631	P51S	probably damaging	Het
Ptpre	C	T	7: 135,669,132	H346Y	probably benign	Het
Rab27b	T	C	18: 69,989,588	D100G	probably damaging	Het
Rpf1	A	G	3: 146,506,538	L349S	probably damaging	Het
Samd14	T	C	11: 95,021,583	S233P	probably damaging	Het
Sema6a	C	A	18: 47,300,128	V79F	probably damaging	Het
Setbp1	A	G	18: 78,857,482	I990T	probably damaging	Het
Setx	A	G	2: 29,180,081	R2633G	probably benign	Het
Siae	T	G	9: 37,646,520	I541S	possibly damaging	Het
Slc13a1	A	G	6: 24,103,429	S372P	possibly damaging	Het
Smarcc2	T	C	10: 128,461,473		probably null	Het
Snrpf	T	C	10: 93,588,123	S2G	probably benign	Het
Speer2	C	A	16: 69,858,820	K39N	probably null	Het
Spink5	T	G	18: 43,986,423	F267C	probably damaging	Het
Tgfbrap1	G	T	1: 43,075,506	R145S	probably damaging	Het
Tmem161b	C	A	13: 84,294,768	T269K	possibly damaging	Het
Tmem64	T	C	4: 15,281,119	I304T	probably damaging	Het
Tomm7	A	G	5: 23,844,006	I23T	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ttr	C	T	18: 20,670,110	A111V	possibly damaging	Het
Usp47	T	A	7: 112,083,882	Y561N	probably damaging	Het
Vmn1r17	A	G	6: 57,360,843	V130A	probably benign	Het
Wdr45b	A	G	11: 121,328,795	I309T	probably benign	Het
Wnt6	T	C	1: 74,784,596	L364P	probably damaging	Het
Zc3h13	T	C	14: 75,336,009	L1530P	probably damaging	Het
Zfp933	A	G	4: 147,826,864	W60R	probably benign	Het

Other mutations in Il17ra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01367:Il17ra	APN	6	120481465	missense	probably damaging	1.00
IGL01413:Il17ra	APN	6	120475581	missense	probably benign	0.00
IGL01418:Il17ra	APN	6	120475581	missense	probably benign	0.00
IGL03215:Il17ra	APN	6	120472114	missense	probably damaging	1.00
IGL03047:Il17ra	UTSW	6	120481226	missense	probably damaging	1.00
PIT4305001:Il17ra	UTSW	6	120481406	missense	probably damaging	1.00
R0042:Il17ra	UTSW	6	120472125	splice site	probably benign
R0042:Il17ra	UTSW	6	120472125	splice site	probably benign
R0365:Il17ra	UTSW	6	120478449	missense	probably benign	0.03
R0391:Il17ra	UTSW	6	120476979	splice site	probably benign
R0470:Il17ra	UTSW	6	120481806	missense	probably benign	0.01
R0599:Il17ra	UTSW	6	120481505	missense	probably damaging	1.00
R1525:Il17ra	UTSW	6	120473790	missense	probably damaging	0.98
R1900:Il17ra	UTSW	6	120477394	critical splice acceptor site	probably null
R1972:Il17ra	UTSW	6	120482216	missense	probably benign	0.01
R4192:Il17ra	UTSW	6	120481511	missense	probably damaging	1.00
R4923:Il17ra	UTSW	6	120477445	missense	possibly damaging	0.94
R5009:Il17ra	UTSW	6	120482207	missense	probably benign	0.00
R5411:Il17ra	UTSW	6	120481442	missense	probably damaging	1.00
R5548:Il17ra	UTSW	6	120478473	missense	probably benign	0.23
R6137:Il17ra	UTSW	6	120475582	missense	probably benign	0.23
R6190:Il17ra	UTSW	6	120475273	missense	probably damaging	1.00
R7202:Il17ra	UTSW	6	120475611	missense	probably benign	0.01
R7300:Il17ra	UTSW	6	120482102	missense	probably benign	0.00
R8130:Il17ra	UTSW	6	120478455	missense	probably benign	0.01
R8152:Il17ra	UTSW	6	120482102	missense	probably benign	0.00
R8213:Il17ra	UTSW	6	120473034	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- TTTTCACTGCAGCCATGAACATG -3'
(R):5'- CAGCAGTGGGTCTTCAAACAC -3'

Sequencing Primer
(F):5'- TGATCCTGCCAGACTTCAAGAGG -3'
(R):5'- CTTCTTCATCCAGGGAGGGAAGATC -3'

Posted On

2016-06-21