Incidental Mutation 'R5133:Dsp'
ID395958
Institutional Source Beutler Lab
Gene Symbol Dsp
Ensembl Gene ENSMUSG00000054889
Gene Namedesmoplakin
Synonyms5730453H04Rik, DP, 2300002E22Rik
MMRRC Submission 042721-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5133 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location38151294-38198577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38197702 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 2808 (D2808N)
Ref Sequence ENSEMBL: ENSMUSP00000115062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]
Predicted Effect possibly damaging
Transcript: ENSMUST00000124830
AA Change: D2808N

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: D2808N

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-96 BLAST
Blast:SPEC 783 894 4e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1370 N/A INTRINSIC
coiled coil region 1394 1956 N/A INTRINSIC
low complexity region 1997 2011 N/A INTRINSIC
PLEC 2021 2057 3.33e-1 SMART
PLEC 2058 2095 3.76e-9 SMART
PLEC 2096 2133 4.09e-10 SMART
PLEC 2134 2171 2.09e-7 SMART
PLEC 2175 2209 4.83e1 SMART
PLEC 2210 2245 5.67e1 SMART
PLEC 2263 2300 1.22e-8 SMART
PLEC 2301 2338 1.16e-9 SMART
PLEC 2339 2376 1.12e-7 SMART
PLEC 2377 2414 1.56e-6 SMART
PLEC 2418 2452 1.42e0 SMART
PLEC 2468 2505 3.7e-8 SMART
low complexity region 2507 2517 N/A INTRINSIC
PLEC 2519 2556 3.73e-4 SMART
low complexity region 2577 2593 N/A INTRINSIC
PLEC 2622 2659 1.46e-6 SMART
PLEC 2660 2697 6.69e-15 SMART
PLEC 2698 2735 1.98e2 SMART
PLEC 2736 2773 2.35e-10 SMART
PLEC 2774 2811 1.39e-3 SMART
low complexity region 2835 2860 N/A INTRINSIC
low complexity region 2867 2879 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000127906
AA Change: D2209N

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: D2209N

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-95 BLAST
Blast:SPEC 783 894 3e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1357 N/A INTRINSIC
low complexity region 1398 1412 N/A INTRINSIC
PLEC 1422 1458 3.33e-1 SMART
PLEC 1459 1496 3.76e-9 SMART
PLEC 1497 1534 4.09e-10 SMART
PLEC 1535 1572 2.09e-7 SMART
PLEC 1576 1610 4.83e1 SMART
PLEC 1611 1646 5.67e1 SMART
PLEC 1664 1701 1.22e-8 SMART
PLEC 1702 1739 1.16e-9 SMART
PLEC 1740 1777 1.12e-7 SMART
PLEC 1778 1815 1.56e-6 SMART
PLEC 1819 1853 1.42e0 SMART
PLEC 1869 1906 3.7e-8 SMART
low complexity region 1908 1918 N/A INTRINSIC
PLEC 1920 1957 3.73e-4 SMART
low complexity region 1978 1994 N/A INTRINSIC
PLEC 2023 2060 1.46e-6 SMART
PLEC 2061 2098 6.69e-15 SMART
PLEC 2099 2136 1.98e2 SMART
PLEC 2137 2174 2.35e-10 SMART
PLEC 2175 2212 1.39e-3 SMART
low complexity region 2236 2261 N/A INTRINSIC
low complexity region 2268 2280 N/A INTRINSIC
Meta Mutation Damage Score 0.1785 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik C T 18: 57,563,969 T65I possibly damaging Het
A3galt2 A T 4: 128,762,141 T101S probably damaging Het
Abraxas2 C T 7: 132,883,146 A306V probably benign Het
Acvr1c T A 2: 58,283,506 N248I probably damaging Het
Adgrv1 C T 13: 81,439,441 R4537Q probably damaging Het
Adrb3 A C 8: 27,227,770 M217R probably damaging Het
Afg3l1 T C 8: 123,489,793 V257A probably benign Het
Agbl1 C A 7: 76,422,156 Q334K probably benign Het
Aox4 A T 1: 58,236,676 D389V probably benign Het
Apob A T 12: 8,008,898 Q2427L probably damaging Het
Asxl3 T C 18: 22,516,708 C585R probably damaging Het
Baz2a G A 10: 128,116,126 G571D probably damaging Het
Baz2b A T 2: 59,962,024 S587T probably benign Het
Bicdl2 T C 17: 23,661,821 L14P unknown Het
Cachd1 G A 4: 100,994,738 S1177N probably damaging Het
Cacna2d3 A G 14: 29,293,178 F86L possibly damaging Het
Cd3d A T 9: 44,984,998 E28D probably damaging Het
Cmya5 T C 13: 93,093,372 K1736R possibly damaging Het
Col12a1 A G 9: 79,605,174 V2913A probably damaging Het
Cops8 A G 1: 90,611,002 D51G probably damaging Het
Csgalnact1 T C 8: 68,460,971 E194G probably benign Het
Csn1s1 A G 5: 87,680,878 D267G possibly damaging Het
Cyp2c40 T C 19: 39,807,219 N172S probably benign Het
Dhtkd1 T A 2: 5,904,002 K760N probably damaging Het
Dnah17 T C 11: 118,117,113 K691E probably benign Het
Dppa4 G A 16: 48,292,971 R189Q probably benign Het
Egr2 A G 10: 67,539,775 E17G probably damaging Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Epas1 A G 17: 86,809,454 N184S probably damaging Het
Ezh2 C T 6: 47,540,750 C584Y probably damaging Het
F10 T C 8: 13,055,698 V421A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam186a T G 15: 99,955,493 D122A unknown Het
Fam227b G A 2: 126,116,123 P241S probably damaging Het
Fam234b T C 6: 135,209,195 V67A probably benign Het
Fbn2 T C 18: 58,039,340 D2131G probably damaging Het
Fgfr4 T C 13: 55,160,015 Y271H probably damaging Het
Gm960 T A 19: 4,658,421 S194C probably damaging Het
Gnmt A T 17: 46,725,934 S250T probably benign Het
Golgb1 C A 16: 36,891,457 Q208K possibly damaging Het
Grn C A 11: 102,430,554 probably benign Het
Grwd1 T C 7: 45,825,874 T415A probably benign Het
Gsk3b G A 16: 38,240,520 R418H probably damaging Het
Hap1 T G 11: 100,351,531 M382L probably benign Het
Hspa12b A G 2: 131,139,508 E221G possibly damaging Het
Hspa4l T A 3: 40,786,747 D709E possibly damaging Het
Il17ra A G 6: 120,481,553 E555G possibly damaging Het
Il27ra T C 8: 84,034,059 T426A possibly damaging Het
Jup T C 11: 100,383,115 D200G probably benign Het
Kcnq1 T C 7: 143,194,346 probably null Het
Kctd9 C T 14: 67,729,356 T106I probably damaging Het
Kmt5b T A 19: 3,802,240 H159Q probably damaging Het
Kprp C T 3: 92,824,522 R407Q unknown Het
Kras T C 6: 145,232,153 Q131R probably benign Het
Krt16 T A 11: 100,247,631 R230S probably damaging Het
Lpar6 G A 14: 73,238,707 C36Y probably damaging Het
Lrp10 T C 14: 54,469,610 S635P probably benign Het
Mapre2 C A 18: 23,858,133 H153N possibly damaging Het
Mark3 C A 12: 111,655,328 R703S probably damaging Het
Mboat2 A G 12: 24,959,066 D457G probably benign Het
Med13 T C 11: 86,319,849 D489G probably benign Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Mtus1 T C 8: 41,083,192 T496A probably benign Het
Mum1 T C 10: 80,232,868 L282P probably benign Het
Nckap5 T C 1: 126,033,960 H204R probably benign Het
Nlrc4 G T 17: 74,446,717 P224T possibly damaging Het
Olfr1221 A T 2: 89,111,796 probably null Het
Olfr1434 T C 19: 12,283,306 L86P possibly damaging Het
Olfr1480 T A 19: 13,530,078 M135K probably damaging Het
Olfr60 A T 7: 140,345,323 I222N probably damaging Het
Oprl1 T A 2: 181,718,610 I153N probably damaging Het
Otud4 G A 8: 79,655,689 V176I probably damaging Het
Pcdhb5 T C 18: 37,320,890 F108L probably benign Het
Pde8b T C 13: 95,086,742 I335V probably benign Het
Pdzd7 T A 19: 45,028,429 I886L possibly damaging Het
Prune2 C T 19: 17,003,631 P51S probably damaging Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Rab27b T C 18: 69,989,588 D100G probably damaging Het
Rpf1 A G 3: 146,506,538 L349S probably damaging Het
Samd14 T C 11: 95,021,583 S233P probably damaging Het
Sema6a C A 18: 47,300,128 V79F probably damaging Het
Setbp1 A G 18: 78,857,482 I990T probably damaging Het
Setx A G 2: 29,180,081 R2633G probably benign Het
Siae T G 9: 37,646,520 I541S possibly damaging Het
Slc13a1 A G 6: 24,103,429 S372P possibly damaging Het
Smarcc2 T C 10: 128,461,473 probably null Het
Snrpf T C 10: 93,588,123 S2G probably benign Het
Speer2 C A 16: 69,858,820 K39N probably null Het
Spink5 T G 18: 43,986,423 F267C probably damaging Het
Tgfbrap1 G T 1: 43,075,506 R145S probably damaging Het
Tmem161b C A 13: 84,294,768 T269K possibly damaging Het
Tmem64 T C 4: 15,281,119 I304T probably damaging Het
Tomm7 A G 5: 23,844,006 I23T probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ttr C T 18: 20,670,110 A111V possibly damaging Het
Usp47 T A 7: 112,083,882 Y561N probably damaging Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdr45b A G 11: 121,328,795 I309T probably benign Het
Wnt6 T C 1: 74,784,596 L364P probably damaging Het
Zc3h13 T C 14: 75,336,009 L1530P probably damaging Het
Zfp933 A G 4: 147,826,864 W60R probably benign Het
Other mutations in Dsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Dsp APN 13 38197846 missense probably damaging 0.99
IGL01337:Dsp APN 13 38192687 missense probably benign 0.44
IGL01371:Dsp APN 13 38193617 missense probably benign 0.13
IGL01473:Dsp APN 13 38167571 missense probably damaging 0.99
IGL01660:Dsp APN 13 38176495 missense possibly damaging 0.90
IGL01723:Dsp APN 13 38179084 missense probably damaging 1.00
IGL01999:Dsp APN 13 38181186 missense probably damaging 0.99
IGL02313:Dsp APN 13 38196523 nonsense probably null
IGL02833:Dsp APN 13 38192921 missense possibly damaging 0.56
IGL03050:Dsp APN 13 38188445 splice site probably benign
IGL03353:Dsp APN 13 38186695 missense probably damaging 1.00
R0052:Dsp UTSW 13 38197364 missense possibly damaging 0.93
R0052:Dsp UTSW 13 38197364 missense possibly damaging 0.93
R0078:Dsp UTSW 13 38196017 missense probably benign 0.22
R0230:Dsp UTSW 13 38197705 missense probably benign 0.03
R0234:Dsp UTSW 13 38187893 missense probably benign 0.13
R0234:Dsp UTSW 13 38187893 missense probably benign 0.13
R0285:Dsp UTSW 13 38172794 missense probably benign
R0326:Dsp UTSW 13 38192870 nonsense probably null
R0332:Dsp UTSW 13 38182228 nonsense probably null
R0471:Dsp UTSW 13 38193350 nonsense probably null
R0567:Dsp UTSW 13 38192438 missense probably benign 0.01
R0611:Dsp UTSW 13 38187741 missense probably damaging 1.00
R0718:Dsp UTSW 13 38196764 missense possibly damaging 0.80
R0926:Dsp UTSW 13 38183218 missense probably damaging 0.97
R1078:Dsp UTSW 13 38183106 splice site probably benign
R1183:Dsp UTSW 13 38191740 nonsense probably null
R1188:Dsp UTSW 13 38194963 missense probably damaging 1.00
R1419:Dsp UTSW 13 38186695 missense probably damaging 1.00
R1445:Dsp UTSW 13 38191931 missense probably damaging 0.98
R1467:Dsp UTSW 13 38192712 missense probably benign 0.00
R1467:Dsp UTSW 13 38192712 missense probably benign 0.00
R1478:Dsp UTSW 13 38181138 missense probably damaging 1.00
R1568:Dsp UTSW 13 38175147 missense probably damaging 1.00
R1572:Dsp UTSW 13 38195738 missense probably damaging 1.00
R1676:Dsp UTSW 13 38193374 nonsense probably null
R1736:Dsp UTSW 13 38192990 missense probably benign 0.01
R1776:Dsp UTSW 13 38196617 missense probably damaging 0.99
R1829:Dsp UTSW 13 38193195 missense probably damaging 1.00
R1878:Dsp UTSW 13 38164855 missense possibly damaging 0.53
R2013:Dsp UTSW 13 38191458 missense probably damaging 1.00
R2161:Dsp UTSW 13 38196451 missense probably damaging 1.00
R2187:Dsp UTSW 13 38176407 missense probably damaging 1.00
R2295:Dsp UTSW 13 38197046 missense probably benign 0.28
R2495:Dsp UTSW 13 38193477 missense possibly damaging 0.91
R2566:Dsp UTSW 13 38196404 missense probably damaging 1.00
R2888:Dsp UTSW 13 38192248 missense possibly damaging 0.92
R3012:Dsp UTSW 13 38193342 missense possibly damaging 0.61
R3614:Dsp UTSW 13 38177199 missense probably damaging 0.98
R3725:Dsp UTSW 13 38194689 splice site probably null
R3725:Dsp UTSW 13 38197618 missense probably benign 0.00
R3797:Dsp UTSW 13 38177284 critical splice donor site probably null
R3841:Dsp UTSW 13 38197705 missense probably benign
R4030:Dsp UTSW 13 38191428 missense possibly damaging 0.84
R4124:Dsp UTSW 13 38186713 missense probably damaging 1.00
R4279:Dsp UTSW 13 38185231 missense probably damaging 1.00
R4334:Dsp UTSW 13 38196664 missense possibly damaging 0.46
R4419:Dsp UTSW 13 38195132 missense probably damaging 1.00
R4615:Dsp UTSW 13 38191632 missense probably damaging 0.98
R4627:Dsp UTSW 13 38168641 missense probably benign 0.01
R4639:Dsp UTSW 13 38196784 missense probably damaging 1.00
R4687:Dsp UTSW 13 38191619 missense probably damaging 1.00
R4735:Dsp UTSW 13 38196040 missense probably damaging 0.99
R4746:Dsp UTSW 13 38195104 missense possibly damaging 0.51
R4772:Dsp UTSW 13 38167528 nonsense probably null
R4830:Dsp UTSW 13 38192864 missense probably benign
R4850:Dsp UTSW 13 38192469 missense probably damaging 1.00
R4959:Dsp UTSW 13 38191710 missense probably benign 0.41
R4963:Dsp UTSW 13 38197870 missense probably damaging 0.99
R4969:Dsp UTSW 13 38192910 missense probably benign 0.00
R4978:Dsp UTSW 13 38182234 missense probably damaging 1.00
R4989:Dsp UTSW 13 38197702 missense possibly damaging 0.93
R5068:Dsp UTSW 13 38197123 missense possibly damaging 0.78
R5069:Dsp UTSW 13 38197123 missense possibly damaging 0.78
R5070:Dsp UTSW 13 38197123 missense possibly damaging 0.78
R5138:Dsp UTSW 13 38183298 missense probably benign 0.37
R5138:Dsp UTSW 13 38195845 missense possibly damaging 0.50
R5153:Dsp UTSW 13 38182306 missense probably damaging 1.00
R5199:Dsp UTSW 13 38192902 nonsense probably null
R5226:Dsp UTSW 13 38186770 missense probably damaging 0.99
R5265:Dsp UTSW 13 38195183 missense possibly damaging 0.95
R5371:Dsp UTSW 13 38194889 missense probably damaging 0.97
R5484:Dsp UTSW 13 38184038 missense possibly damaging 0.48
R5534:Dsp UTSW 13 38195842 missense probably benign 0.01
R5569:Dsp UTSW 13 38192652 missense probably benign 0.01
R5854:Dsp UTSW 13 38167501 splice site probably null
R5910:Dsp UTSW 13 38192469 missense possibly damaging 0.95
R5929:Dsp UTSW 13 38195434 missense possibly damaging 0.92
R5940:Dsp UTSW 13 38196026 missense possibly damaging 0.70
R5948:Dsp UTSW 13 38195401 missense possibly damaging 0.95
R5955:Dsp UTSW 13 38194958 missense possibly damaging 0.73
R5970:Dsp UTSW 13 38195702 missense possibly damaging 0.93
R6054:Dsp UTSW 13 38167609 missense probably benign 0.00
R6113:Dsp UTSW 13 38192047 missense probably damaging 1.00
R6139:Dsp UTSW 13 38192406 missense probably damaging 0.97
R6328:Dsp UTSW 13 38197006 nonsense probably null
R6527:Dsp UTSW 13 38195873 missense probably damaging 1.00
R6573:Dsp UTSW 13 38196862 missense probably damaging 1.00
R6628:Dsp UTSW 13 38167622 missense possibly damaging 0.73
R6738:Dsp UTSW 13 38192210 missense possibly damaging 0.87
R6898:Dsp UTSW 13 38192217 missense possibly damaging 0.59
R6919:Dsp UTSW 13 38167655 missense possibly damaging 0.84
R6951:Dsp UTSW 13 38167646 missense possibly damaging 0.95
R7017:Dsp UTSW 13 38186707 missense probably benign 0.02
R7022:Dsp UTSW 13 38191740 missense probably benign 0.06
R7135:Dsp UTSW 13 38179073 missense probably damaging 1.00
R7192:Dsp UTSW 13 38195593 missense probably benign 0.09
R7211:Dsp UTSW 13 38188535 critical splice donor site probably null
R7251:Dsp UTSW 13 38193548 missense probably benign 0.02
R7326:Dsp UTSW 13 38192883 missense probably benign 0.01
R7369:Dsp UTSW 13 38197525 missense possibly damaging 0.82
R7376:Dsp UTSW 13 38172843 missense probably damaging 1.00
R7406:Dsp UTSW 13 38197196 missense possibly damaging 0.63
R7439:Dsp UTSW 13 38176502 critical splice donor site probably null
R7439:Dsp UTSW 13 38195449 missense probably benign 0.00
R7441:Dsp UTSW 13 38195449 missense probably benign 0.00
R7477:Dsp UTSW 13 38172863 missense probably damaging 1.00
R7535:Dsp UTSW 13 38192789 missense probably benign 0.05
R7558:Dsp UTSW 13 38168766 missense probably benign 0.02
R7600:Dsp UTSW 13 38191715 missense probably damaging 1.00
R7616:Dsp UTSW 13 38191482 missense probably damaging 0.98
R7702:Dsp UTSW 13 38175207 missense possibly damaging 0.83
R7738:Dsp UTSW 13 38185175 missense probably damaging 0.97
R7815:Dsp UTSW 13 38191470 missense probably benign 0.31
R7882:Dsp UTSW 13 38184018 missense possibly damaging 0.76
R7917:Dsp UTSW 13 38167639 nonsense probably null
R7971:Dsp UTSW 13 38192523 missense probably damaging 0.97
R8104:Dsp UTSW 13 38168624 missense probably benign 0.03
R8176:Dsp UTSW 13 38192810 missense possibly damaging 0.56
R8303:Dsp UTSW 13 38197343 missense probably benign
R8323:Dsp UTSW 13 38172830 missense possibly damaging 0.80
R8326:Dsp UTSW 13 38191635 missense probably damaging 1.00
R8358:Dsp UTSW 13 38192481 missense possibly damaging 0.92
R8410:Dsp UTSW 13 38196815 missense possibly damaging 0.94
R8552:Dsp UTSW 13 38185141 missense probably damaging 0.98
X0023:Dsp UTSW 13 38197684 missense probably benign 0.00
X0024:Dsp UTSW 13 38193255 missense probably benign 0.04
X0027:Dsp UTSW 13 38186646 missense possibly damaging 0.68
X0067:Dsp UTSW 13 38182312 missense possibly damaging 0.85
Z1176:Dsp UTSW 13 38197190 missense possibly damaging 0.81
Z1177:Dsp UTSW 13 38151689 missense probably benign 0.01
Z1177:Dsp UTSW 13 38192854 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGAAATGGCTTCCCTACGAGG -3'
(R):5'- AGCATCGAAGCTTCCTCTCC -3'

Sequencing Primer
(F):5'- TGGAGTTCCAGTTCCTCACGG -3'
(R):5'- ATCGAAGCTTCCTCTCCGAGAC -3'
Posted On2016-06-21