Mutagenetix > Incidental Mutation

Incidental Mutation 'R5133:Dsp'

395958

Institutional Source

Beutler Lab

Gene Symbol

Dsp

Ensembl Gene

ENSMUSG00000054889

Gene Name

desmoplakin

Synonyms

5730453H04Rik, DP, 2300002E22Rik

MMRRC Submission

042721-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5133 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

38151294-38198577 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 38197702 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 2808 (D2808N)

Ref Sequence

ENSEMBL: ENSMUSP00000115062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124830
AA Change: D2808N

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: D2808N

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-96	BLAST
Blast:SPEC	783	894	4e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1370	N/A	INTRINSIC
coiled coil region	1394	1956	N/A	INTRINSIC
low complexity region	1997	2011	N/A	INTRINSIC
PLEC	2021	2057	3.33e-1	SMART
PLEC	2058	2095	3.76e-9	SMART
PLEC	2096	2133	4.09e-10	SMART
PLEC	2134	2171	2.09e-7	SMART
PLEC	2175	2209	4.83e1	SMART
PLEC	2210	2245	5.67e1	SMART
PLEC	2263	2300	1.22e-8	SMART
PLEC	2301	2338	1.16e-9	SMART
PLEC	2339	2376	1.12e-7	SMART
PLEC	2377	2414	1.56e-6	SMART
PLEC	2418	2452	1.42e0	SMART
PLEC	2468	2505	3.7e-8	SMART
low complexity region	2507	2517	N/A	INTRINSIC
PLEC	2519	2556	3.73e-4	SMART
low complexity region	2577	2593	N/A	INTRINSIC
PLEC	2622	2659	1.46e-6	SMART
PLEC	2660	2697	6.69e-15	SMART
PLEC	2698	2735	1.98e2	SMART
PLEC	2736	2773	2.35e-10	SMART
PLEC	2774	2811	1.39e-3	SMART
low complexity region	2835	2860	N/A	INTRINSIC
low complexity region	2867	2879	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000127906
AA Change: D2209N

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: D2209N

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-95	BLAST
Blast:SPEC	783	894	3e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1357	N/A	INTRINSIC
low complexity region	1398	1412	N/A	INTRINSIC
PLEC	1422	1458	3.33e-1	SMART
PLEC	1459	1496	3.76e-9	SMART
PLEC	1497	1534	4.09e-10	SMART
PLEC	1535	1572	2.09e-7	SMART
PLEC	1576	1610	4.83e1	SMART
PLEC	1611	1646	5.67e1	SMART
PLEC	1664	1701	1.22e-8	SMART
PLEC	1702	1739	1.16e-9	SMART
PLEC	1740	1777	1.12e-7	SMART
PLEC	1778	1815	1.56e-6	SMART
PLEC	1819	1853	1.42e0	SMART
PLEC	1869	1906	3.7e-8	SMART
low complexity region	1908	1918	N/A	INTRINSIC
PLEC	1920	1957	3.73e-4	SMART
low complexity region	1978	1994	N/A	INTRINSIC
PLEC	2023	2060	1.46e-6	SMART
PLEC	2061	2098	6.69e-15	SMART
PLEC	2099	2136	1.98e2	SMART
PLEC	2137	2174	2.35e-10	SMART
PLEC	2175	2212	1.39e-3	SMART
low complexity region	2236	2261	N/A	INTRINSIC
low complexity region	2268	2280	N/A	INTRINSIC

Meta Mutation Damage Score

0.1785

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011I03Rik	C	T	18: 57,563,969	T65I	possibly damaging	Het
A3galt2	A	T	4: 128,762,141	T101S	probably damaging	Het
Abraxas2	C	T	7: 132,883,146	A306V	probably benign	Het
Acvr1c	T	A	2: 58,283,506	N248I	probably damaging	Het
Adgrv1	C	T	13: 81,439,441	R4537Q	probably damaging	Het
Adrb3	A	C	8: 27,227,770	M217R	probably damaging	Het
Afg3l1	T	C	8: 123,489,793	V257A	probably benign	Het
Agbl1	C	A	7: 76,422,156	Q334K	probably benign	Het
Aox4	A	T	1: 58,236,676	D389V	probably benign	Het
Apob	A	T	12: 8,008,898	Q2427L	probably damaging	Het
Asxl3	T	C	18: 22,516,708	C585R	probably damaging	Het
Baz2a	G	A	10: 128,116,126	G571D	probably damaging	Het
Baz2b	A	T	2: 59,962,024	S587T	probably benign	Het
Bicdl2	T	C	17: 23,661,821	L14P	unknown	Het
Cachd1	G	A	4: 100,994,738	S1177N	probably damaging	Het
Cacna2d3	A	G	14: 29,293,178	F86L	possibly damaging	Het
Cd3d	A	T	9: 44,984,998	E28D	probably damaging	Het
Cmya5	T	C	13: 93,093,372	K1736R	possibly damaging	Het
Col12a1	A	G	9: 79,605,174	V2913A	probably damaging	Het
Cops8	A	G	1: 90,611,002	D51G	probably damaging	Het
Csgalnact1	T	C	8: 68,460,971	E194G	probably benign	Het
Csn1s1	A	G	5: 87,680,878	D267G	possibly damaging	Het
Cyp2c40	T	C	19: 39,807,219	N172S	probably benign	Het
Dhtkd1	T	A	2: 5,904,002	K760N	probably damaging	Het
Dnah17	T	C	11: 118,117,113	K691E	probably benign	Het
Dppa4	G	A	16: 48,292,971	R189Q	probably benign	Het
Egr2	A	G	10: 67,539,775	E17G	probably damaging	Het
Ehmt1	G	T	2: 24,877,497	P135T	probably damaging	Het
Epas1	A	G	17: 86,809,454	N184S	probably damaging	Het
Ezh2	C	T	6: 47,540,750	C584Y	probably damaging	Het
F10	T	C	8: 13,055,698	V421A	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam186a	T	G	15: 99,955,493	D122A	unknown	Het
Fam227b	G	A	2: 126,116,123	P241S	probably damaging	Het
Fam234b	T	C	6: 135,209,195	V67A	probably benign	Het
Fbn2	T	C	18: 58,039,340	D2131G	probably damaging	Het
Fgfr4	T	C	13: 55,160,015	Y271H	probably damaging	Het
Gm960	T	A	19: 4,658,421	S194C	probably damaging	Het
Gnmt	A	T	17: 46,725,934	S250T	probably benign	Het
Golgb1	C	A	16: 36,891,457	Q208K	possibly damaging	Het
Grn	C	A	11: 102,430,554		probably benign	Het
Grwd1	T	C	7: 45,825,874	T415A	probably benign	Het
Gsk3b	G	A	16: 38,240,520	R418H	probably damaging	Het
Hap1	T	G	11: 100,351,531	M382L	probably benign	Het
Hspa12b	A	G	2: 131,139,508	E221G	possibly damaging	Het
Hspa4l	T	A	3: 40,786,747	D709E	possibly damaging	Het
Il17ra	A	G	6: 120,481,553	E555G	possibly damaging	Het
Il27ra	T	C	8: 84,034,059	T426A	possibly damaging	Het
Jup	T	C	11: 100,383,115	D200G	probably benign	Het
Kcnq1	T	C	7: 143,194,346		probably null	Het
Kctd9	C	T	14: 67,729,356	T106I	probably damaging	Het
Kmt5b	T	A	19: 3,802,240	H159Q	probably damaging	Het
Kprp	C	T	3: 92,824,522	R407Q	unknown	Het
Kras	T	C	6: 145,232,153	Q131R	probably benign	Het
Krt16	T	A	11: 100,247,631	R230S	probably damaging	Het
Lpar6	G	A	14: 73,238,707	C36Y	probably damaging	Het
Lrp10	T	C	14: 54,469,610	S635P	probably benign	Het
Mapre2	C	A	18: 23,858,133	H153N	possibly damaging	Het
Mark3	C	A	12: 111,655,328	R703S	probably damaging	Het
Mboat2	A	G	12: 24,959,066	D457G	probably benign	Het
Med13	T	C	11: 86,319,849	D489G	probably benign	Het
Msh2	C	A	17: 87,723,413	A906E	probably benign	Het
Mtus1	T	C	8: 41,083,192	T496A	probably benign	Het
Mum1	T	C	10: 80,232,868	L282P	probably benign	Het
Nckap5	T	C	1: 126,033,960	H204R	probably benign	Het
Nlrc4	G	T	17: 74,446,717	P224T	possibly damaging	Het
Olfr1221	A	T	2: 89,111,796		probably null	Het
Olfr1434	T	C	19: 12,283,306	L86P	possibly damaging	Het
Olfr1480	T	A	19: 13,530,078	M135K	probably damaging	Het
Olfr60	A	T	7: 140,345,323	I222N	probably damaging	Het
Oprl1	T	A	2: 181,718,610	I153N	probably damaging	Het
Otud4	G	A	8: 79,655,689	V176I	probably damaging	Het
Pcdhb5	T	C	18: 37,320,890	F108L	probably benign	Het
Pde8b	T	C	13: 95,086,742	I335V	probably benign	Het
Pdzd7	T	A	19: 45,028,429	I886L	possibly damaging	Het
Prune2	C	T	19: 17,003,631	P51S	probably damaging	Het
Ptpre	C	T	7: 135,669,132	H346Y	probably benign	Het
Rab27b	T	C	18: 69,989,588	D100G	probably damaging	Het
Rpf1	A	G	3: 146,506,538	L349S	probably damaging	Het
Samd14	T	C	11: 95,021,583	S233P	probably damaging	Het
Sema6a	C	A	18: 47,300,128	V79F	probably damaging	Het
Setbp1	A	G	18: 78,857,482	I990T	probably damaging	Het
Setx	A	G	2: 29,180,081	R2633G	probably benign	Het
Siae	T	G	9: 37,646,520	I541S	possibly damaging	Het
Slc13a1	A	G	6: 24,103,429	S372P	possibly damaging	Het
Smarcc2	T	C	10: 128,461,473		probably null	Het
Snrpf	T	C	10: 93,588,123	S2G	probably benign	Het
Speer2	C	A	16: 69,858,820	K39N	probably null	Het
Spink5	T	G	18: 43,986,423	F267C	probably damaging	Het
Tgfbrap1	G	T	1: 43,075,506	R145S	probably damaging	Het
Tmem161b	C	A	13: 84,294,768	T269K	possibly damaging	Het
Tmem64	T	C	4: 15,281,119	I304T	probably damaging	Het
Tomm7	A	G	5: 23,844,006	I23T	probably benign	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ttr	C	T	18: 20,670,110	A111V	possibly damaging	Het
Usp47	T	A	7: 112,083,882	Y561N	probably damaging	Het
Vmn1r17	A	G	6: 57,360,843	V130A	probably benign	Het
Wdr45b	A	G	11: 121,328,795	I309T	probably benign	Het
Wnt6	T	C	1: 74,784,596	L364P	probably damaging	Het
Zc3h13	T	C	14: 75,336,009	L1530P	probably damaging	Het
Zfp933	A	G	4: 147,826,864	W60R	probably benign	Het

Other mutations in Dsp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Dsp	APN	13	38197846	missense	probably damaging	0.99
IGL01337:Dsp	APN	13	38192687	missense	probably benign	0.44
IGL01371:Dsp	APN	13	38193617	missense	probably benign	0.13
IGL01473:Dsp	APN	13	38167571	missense	probably damaging	0.99
IGL01660:Dsp	APN	13	38176495	missense	possibly damaging	0.90
IGL01723:Dsp	APN	13	38179084	missense	probably damaging	1.00
IGL01999:Dsp	APN	13	38181186	missense	probably damaging	0.99
IGL02313:Dsp	APN	13	38196523	nonsense	probably null
IGL02833:Dsp	APN	13	38192921	missense	possibly damaging	0.56
IGL03050:Dsp	APN	13	38188445	splice site	probably benign
IGL03353:Dsp	APN	13	38186695	missense	probably damaging	1.00
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0078:Dsp	UTSW	13	38196017	missense	probably benign	0.22
R0230:Dsp	UTSW	13	38197705	missense	probably benign	0.03
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0285:Dsp	UTSW	13	38172794	missense	probably benign
R0326:Dsp	UTSW	13	38192870	nonsense	probably null
R0332:Dsp	UTSW	13	38182228	nonsense	probably null
R0471:Dsp	UTSW	13	38193350	nonsense	probably null
R0567:Dsp	UTSW	13	38192438	missense	probably benign	0.01
R0611:Dsp	UTSW	13	38187741	missense	probably damaging	1.00
R0718:Dsp	UTSW	13	38196764	missense	possibly damaging	0.80
R0926:Dsp	UTSW	13	38183218	missense	probably damaging	0.97
R1078:Dsp	UTSW	13	38183106	splice site	probably benign
R1183:Dsp	UTSW	13	38191740	nonsense	probably null
R1188:Dsp	UTSW	13	38194963	missense	probably damaging	1.00
R1419:Dsp	UTSW	13	38186695	missense	probably damaging	1.00
R1445:Dsp	UTSW	13	38191931	missense	probably damaging	0.98
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1478:Dsp	UTSW	13	38181138	missense	probably damaging	1.00
R1568:Dsp	UTSW	13	38175147	missense	probably damaging	1.00
R1572:Dsp	UTSW	13	38195738	missense	probably damaging	1.00
R1676:Dsp	UTSW	13	38193374	nonsense	probably null
R1736:Dsp	UTSW	13	38192990	missense	probably benign	0.01
R1776:Dsp	UTSW	13	38196617	missense	probably damaging	0.99
R1829:Dsp	UTSW	13	38193195	missense	probably damaging	1.00
R1878:Dsp	UTSW	13	38164855	missense	possibly damaging	0.53
R2013:Dsp	UTSW	13	38191458	missense	probably damaging	1.00
R2161:Dsp	UTSW	13	38196451	missense	probably damaging	1.00
R2187:Dsp	UTSW	13	38176407	missense	probably damaging	1.00
R2295:Dsp	UTSW	13	38197046	missense	probably benign	0.28
R2495:Dsp	UTSW	13	38193477	missense	possibly damaging	0.91
R2566:Dsp	UTSW	13	38196404	missense	probably damaging	1.00
R2888:Dsp	UTSW	13	38192248	missense	possibly damaging	0.92
R3012:Dsp	UTSW	13	38193342	missense	possibly damaging	0.61
R3614:Dsp	UTSW	13	38177199	missense	probably damaging	0.98
R3725:Dsp	UTSW	13	38194689	splice site	probably null
R3725:Dsp	UTSW	13	38197618	missense	probably benign	0.00
R3797:Dsp	UTSW	13	38177284	critical splice donor site	probably null
R3841:Dsp	UTSW	13	38197705	missense	probably benign
R4030:Dsp	UTSW	13	38191428	missense	possibly damaging	0.84
R4124:Dsp	UTSW	13	38186713	missense	probably damaging	1.00
R4279:Dsp	UTSW	13	38185231	missense	probably damaging	1.00
R4334:Dsp	UTSW	13	38196664	missense	possibly damaging	0.46
R4419:Dsp	UTSW	13	38195132	missense	probably damaging	1.00
R4615:Dsp	UTSW	13	38191632	missense	probably damaging	0.98
R4627:Dsp	UTSW	13	38168641	missense	probably benign	0.01
R4639:Dsp	UTSW	13	38196784	missense	probably damaging	1.00
R4687:Dsp	UTSW	13	38191619	missense	probably damaging	1.00
R4735:Dsp	UTSW	13	38196040	missense	probably damaging	0.99
R4746:Dsp	UTSW	13	38195104	missense	possibly damaging	0.51
R4772:Dsp	UTSW	13	38167528	nonsense	probably null
R4830:Dsp	UTSW	13	38192864	missense	probably benign
R4850:Dsp	UTSW	13	38192469	missense	probably damaging	1.00
R4959:Dsp	UTSW	13	38191710	missense	probably benign	0.41
R4963:Dsp	UTSW	13	38197870	missense	probably damaging	0.99
R4969:Dsp	UTSW	13	38192910	missense	probably benign	0.00
R4978:Dsp	UTSW	13	38182234	missense	probably damaging	1.00
R4989:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5068:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5069:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5070:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5138:Dsp	UTSW	13	38183298	missense	probably benign	0.37
R5138:Dsp	UTSW	13	38195845	missense	possibly damaging	0.50
R5153:Dsp	UTSW	13	38182306	missense	probably damaging	1.00
R5199:Dsp	UTSW	13	38192902	nonsense	probably null
R5226:Dsp	UTSW	13	38186770	missense	probably damaging	0.99
R5265:Dsp	UTSW	13	38195183	missense	possibly damaging	0.95
R5371:Dsp	UTSW	13	38194889	missense	probably damaging	0.97
R5484:Dsp	UTSW	13	38184038	missense	possibly damaging	0.48
R5534:Dsp	UTSW	13	38195842	missense	probably benign	0.01
R5569:Dsp	UTSW	13	38192652	missense	probably benign	0.01
R5854:Dsp	UTSW	13	38167501	splice site	probably null
R5910:Dsp	UTSW	13	38192469	missense	possibly damaging	0.95
R5929:Dsp	UTSW	13	38195434	missense	possibly damaging	0.92
R5940:Dsp	UTSW	13	38196026	missense	possibly damaging	0.70
R5948:Dsp	UTSW	13	38195401	missense	possibly damaging	0.95
R5955:Dsp	UTSW	13	38194958	missense	possibly damaging	0.73
R5970:Dsp	UTSW	13	38195702	missense	possibly damaging	0.93
R6054:Dsp	UTSW	13	38167609	missense	probably benign	0.00
R6113:Dsp	UTSW	13	38192047	missense	probably damaging	1.00
R6139:Dsp	UTSW	13	38192406	missense	probably damaging	0.97
R6328:Dsp	UTSW	13	38197006	nonsense	probably null
R6527:Dsp	UTSW	13	38195873	missense	probably damaging	1.00
R6573:Dsp	UTSW	13	38196862	missense	probably damaging	1.00
R6628:Dsp	UTSW	13	38167622	missense	possibly damaging	0.73
R6738:Dsp	UTSW	13	38192210	missense	possibly damaging	0.87
R6898:Dsp	UTSW	13	38192217	missense	possibly damaging	0.59
R6919:Dsp	UTSW	13	38167655	missense	possibly damaging	0.84
R6951:Dsp	UTSW	13	38167646	missense	possibly damaging	0.95
R7017:Dsp	UTSW	13	38186707	missense	probably benign	0.02
R7022:Dsp	UTSW	13	38191740	missense	probably benign	0.06
R7135:Dsp	UTSW	13	38179073	missense	probably damaging	1.00
R7192:Dsp	UTSW	13	38195593	missense	probably benign	0.09
R7211:Dsp	UTSW	13	38188535	critical splice donor site	probably null
R7251:Dsp	UTSW	13	38193548	missense	probably benign	0.02
R7326:Dsp	UTSW	13	38192883	missense	probably benign	0.01
R7369:Dsp	UTSW	13	38197525	missense	possibly damaging	0.82
R7376:Dsp	UTSW	13	38172843	missense	probably damaging	1.00
R7406:Dsp	UTSW	13	38197196	missense	possibly damaging	0.63
R7439:Dsp	UTSW	13	38176502	critical splice donor site	probably null
R7439:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7441:Dsp	UTSW	13	38195449	missense	probably benign	0.00
R7477:Dsp	UTSW	13	38172863	missense	probably damaging	1.00
R7535:Dsp	UTSW	13	38192789	missense	probably benign	0.05
R7558:Dsp	UTSW	13	38168766	missense	probably benign	0.02
R7600:Dsp	UTSW	13	38191715	missense	probably damaging	1.00
R7616:Dsp	UTSW	13	38191482	missense	probably damaging	0.98
R7702:Dsp	UTSW	13	38175207	missense	possibly damaging	0.83
R7738:Dsp	UTSW	13	38185175	missense	probably damaging	0.97
R7815:Dsp	UTSW	13	38191470	missense	probably benign	0.31
R7882:Dsp	UTSW	13	38184018	missense	possibly damaging	0.76
R7917:Dsp	UTSW	13	38167639	nonsense	probably null
R7971:Dsp	UTSW	13	38192523	missense	probably damaging	0.97
R8104:Dsp	UTSW	13	38168624	missense	probably benign	0.03
R8176:Dsp	UTSW	13	38192810	missense	possibly damaging	0.56
R8303:Dsp	UTSW	13	38197343	missense	probably benign
R8323:Dsp	UTSW	13	38172830	missense	possibly damaging	0.80
R8326:Dsp	UTSW	13	38191635	missense	probably damaging	1.00
R8358:Dsp	UTSW	13	38192481	missense	possibly damaging	0.92
R8410:Dsp	UTSW	13	38196815	missense	possibly damaging	0.94
R8552:Dsp	UTSW	13	38185141	missense	probably damaging	0.98
R8713:Dsp	UTSW	13	38168725	missense	probably damaging	0.99
R8801:Dsp	UTSW	13	38197526	missense	possibly damaging	0.81
R8900:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8901:Dsp	UTSW	13	38181179	missense	probably damaging	0.99
R8968:Dsp	UTSW	13	38151620	missense	possibly damaging	0.83
R9014:Dsp	UTSW	13	38192724	missense	possibly damaging	0.83
R9021:Dsp	UTSW	13	38196832	missense	possibly damaging	0.61
R9030:Dsp	UTSW	13	38168697	missense	probably damaging	1.00
R9124:Dsp	UTSW	13	38193300	missense	probably benign	0.42
R9129:Dsp	UTSW	13	38193150	missense	probably benign	0.09
R9143:Dsp	UTSW	13	38193361	missense	probably benign	0.05
R9450:Dsp	UTSW	13	38192403	missense	probably damaging	1.00
R9488:Dsp	UTSW	13	38193242	missense	probably benign	0.04
R9514:Dsp	UTSW	13	38187805	missense	probably benign	0.02
R9789:Dsp	UTSW	13	38183961	missense	probably benign	0.03
R9792:Dsp	UTSW	13	38195518	missense	possibly damaging	0.87
X0023:Dsp	UTSW	13	38197684	missense	probably benign	0.00
X0024:Dsp	UTSW	13	38193255	missense	probably benign	0.04
X0027:Dsp	UTSW	13	38186646	missense	possibly damaging	0.68
X0067:Dsp	UTSW	13	38182312	missense	possibly damaging	0.85
Z1176:Dsp	UTSW	13	38197190	missense	possibly damaging	0.81
Z1177:Dsp	UTSW	13	38151689	missense	probably benign	0.01
Z1177:Dsp	UTSW	13	38192854	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AGAAATGGCTTCCCTACGAGG -3'
(R):5'- AGCATCGAAGCTTCCTCTCC -3'

Sequencing Primer
(F):5'- TGGAGTTCCAGTTCCTCACGG -3'
(R):5'- ATCGAAGCTTCCTCTCCGAGAC -3'

Posted On

2016-06-21