Incidental Mutation 'R5133:Zc3h13'
ID 395967
Institutional Source Beutler Lab
Gene Symbol Zc3h13
Ensembl Gene ENSMUSG00000022000
Gene Name zinc finger CCCH type containing 13
Synonyms 3110050K21Rik, C87618, 4930570G11Rik, 2600010B19Rik
MMRRC Submission 042721-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.959) question?
Stock # R5133 (G1)
Quality Score 174
Status Not validated
Chromosome 14
Chromosomal Location 75521813-75581866 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75573449 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1530 (L1530P)
Ref Sequence ENSEMBL: ENSMUSP00000022577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022577] [ENSMUST00000227049]
AlphaFold E9Q784
Predicted Effect probably damaging
Transcript: ENSMUST00000022577
AA Change: L1530P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022577
Gene: ENSMUSG00000022000
AA Change: L1530P

DomainStartEndE-ValueType
ZnF_C3H1 36 63 4.54e-4 SMART
low complexity region 136 145 N/A INTRINSIC
coiled coil region 162 197 N/A INTRINSIC
low complexity region 204 233 N/A INTRINSIC
low complexity region 261 269 N/A INTRINSIC
low complexity region 278 287 N/A INTRINSIC
low complexity region 321 357 N/A INTRINSIC
low complexity region 411 478 N/A INTRINSIC
low complexity region 482 493 N/A INTRINSIC
low complexity region 496 575 N/A INTRINSIC
low complexity region 684 701 N/A INTRINSIC
coiled coil region 706 865 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
internal_repeat_1 921 948 1.8e-6 PROSPERO
low complexity region 964 985 N/A INTRINSIC
low complexity region 1032 1052 N/A INTRINSIC
low complexity region 1071 1087 N/A INTRINSIC
low complexity region 1160 1218 N/A INTRINSIC
low complexity region 1253 1265 N/A INTRINSIC
internal_repeat_1 1273 1301 1.8e-6 PROSPERO
low complexity region 1325 1349 N/A INTRINSIC
low complexity region 1366 1391 N/A INTRINSIC
low complexity region 1400 1425 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1690 1697 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000227049
AA Change: L1531P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228470
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9) 

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A3galt2 A T 4: 128,655,934 (GRCm39) T101S probably damaging Het
Abraxas2 C T 7: 132,484,875 (GRCm39) A306V probably benign Het
Acvr1c T A 2: 58,173,518 (GRCm39) N248I probably damaging Het
Adgrv1 C T 13: 81,587,560 (GRCm39) R4537Q probably damaging Het
Adrb3 A C 8: 27,717,798 (GRCm39) M217R probably damaging Het
Afg3l1 T C 8: 124,216,532 (GRCm39) V257A probably benign Het
Agbl1 C A 7: 76,071,904 (GRCm39) Q334K probably benign Het
Aox4 A T 1: 58,275,835 (GRCm39) D389V probably benign Het
Apob A T 12: 8,058,898 (GRCm39) Q2427L probably damaging Het
Asxl3 T C 18: 22,649,765 (GRCm39) C585R probably damaging Het
Baz2a G A 10: 127,951,995 (GRCm39) G571D probably damaging Het
Baz2b A T 2: 59,792,368 (GRCm39) S587T probably benign Het
Bicdl2 T C 17: 23,880,795 (GRCm39) L14P unknown Het
Cachd1 G A 4: 100,851,935 (GRCm39) S1177N probably damaging Het
Cacna2d3 A G 14: 29,015,135 (GRCm39) F86L possibly damaging Het
Ccdc192 C T 18: 57,697,041 (GRCm39) T65I possibly damaging Het
Cd3d A T 9: 44,896,296 (GRCm39) E28D probably damaging Het
Cmya5 T C 13: 93,229,880 (GRCm39) K1736R possibly damaging Het
Col12a1 A G 9: 79,512,456 (GRCm39) V2913A probably damaging Het
Cops8 A G 1: 90,538,724 (GRCm39) D51G probably damaging Het
Csgalnact1 T C 8: 68,913,623 (GRCm39) E194G probably benign Het
Csn1s1 A G 5: 87,828,737 (GRCm39) D267G possibly damaging Het
Cyp2c40 T C 19: 39,795,663 (GRCm39) N172S probably benign Het
Dhtkd1 T A 2: 5,908,813 (GRCm39) K760N probably damaging Het
Dnah17 T C 11: 118,007,939 (GRCm39) K691E probably benign Het
Dppa4 G A 16: 48,113,334 (GRCm39) R189Q probably benign Het
Dsp G A 13: 38,381,678 (GRCm39) D2808N possibly damaging Het
Egr2 A G 10: 67,375,605 (GRCm39) E17G probably damaging Het
Ehmt1 G T 2: 24,767,509 (GRCm39) P135T probably damaging Het
Epas1 A G 17: 87,116,882 (GRCm39) N184S probably damaging Het
Ezh2 C T 6: 47,517,684 (GRCm39) C584Y probably damaging Het
F10 T C 8: 13,105,698 (GRCm39) V421A probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam186a T G 15: 99,853,374 (GRCm39) D122A unknown Het
Fam227b G A 2: 125,958,043 (GRCm39) P241S probably damaging Het
Fam234b T C 6: 135,186,193 (GRCm39) V67A probably benign Het
Fbn2 T C 18: 58,172,412 (GRCm39) D2131G probably damaging Het
Fgfr4 T C 13: 55,307,828 (GRCm39) Y271H probably damaging Het
Gnmt A T 17: 47,036,860 (GRCm39) S250T probably benign Het
Golgb1 C A 16: 36,711,819 (GRCm39) Q208K possibly damaging Het
Grn C A 11: 102,321,380 (GRCm39) probably benign Het
Grwd1 T C 7: 45,475,298 (GRCm39) T415A probably benign Het
Gsk3b G A 16: 38,060,882 (GRCm39) R418H probably damaging Het
Hap1 T G 11: 100,242,357 (GRCm39) M382L probably benign Het
Hspa12b A G 2: 130,981,428 (GRCm39) E221G possibly damaging Het
Hspa4l T A 3: 40,741,179 (GRCm39) D709E possibly damaging Het
Il17ra A G 6: 120,458,514 (GRCm39) E555G possibly damaging Het
Il27ra T C 8: 84,760,688 (GRCm39) T426A possibly damaging Het
Jup T C 11: 100,273,941 (GRCm39) D200G probably benign Het
Kcnq1 T C 7: 142,748,083 (GRCm39) probably null Het
Kctd9 C T 14: 67,966,805 (GRCm39) T106I probably damaging Het
Kmt5b T A 19: 3,852,240 (GRCm39) H159Q probably damaging Het
Kprp C T 3: 92,731,829 (GRCm39) R407Q unknown Het
Kras T C 6: 145,177,879 (GRCm39) Q131R probably benign Het
Krt16 T A 11: 100,138,457 (GRCm39) R230S probably damaging Het
Lpar6 G A 14: 73,476,147 (GRCm39) C36Y probably damaging Het
Lrp10 T C 14: 54,707,067 (GRCm39) S635P probably benign Het
Mapre2 C A 18: 23,991,190 (GRCm39) H153N possibly damaging Het
Mark3 C A 12: 111,621,762 (GRCm39) R703S probably damaging Het
Mboat2 A G 12: 25,009,065 (GRCm39) D457G probably benign Het
Med13 T C 11: 86,210,675 (GRCm39) D489G probably benign Het
Msh2 C A 17: 88,030,841 (GRCm39) A906E probably benign Het
Mtus1 T C 8: 41,536,229 (GRCm39) T496A probably benign Het
Nckap5 T C 1: 125,961,697 (GRCm39) H204R probably benign Het
Nlrc4 G T 17: 74,753,712 (GRCm39) P224T possibly damaging Het
Oprl1 T A 2: 181,360,403 (GRCm39) I153N probably damaging Het
Or13a27 A T 7: 139,925,236 (GRCm39) I222N probably damaging Het
Or4c116 A T 2: 88,942,140 (GRCm39) probably null Het
Or5an1 T C 19: 12,260,670 (GRCm39) L86P possibly damaging Het
Or5b121 T A 19: 13,507,442 (GRCm39) M135K probably damaging Het
Otud4 G A 8: 80,382,318 (GRCm39) V176I probably damaging Het
Pcdhb5 T C 18: 37,453,943 (GRCm39) F108L probably benign Het
Pde8b T C 13: 95,223,250 (GRCm39) I335V probably benign Het
Pdzd7 T A 19: 45,016,868 (GRCm39) I886L possibly damaging Het
Prune2 C T 19: 16,980,995 (GRCm39) P51S probably damaging Het
Ptpre C T 7: 135,270,861 (GRCm39) H346Y probably benign Het
Pwwp3a T C 10: 80,068,702 (GRCm39) L282P probably benign Het
Rab27b T C 18: 70,122,659 (GRCm39) D100G probably damaging Het
Rpf1 A G 3: 146,212,293 (GRCm39) L349S probably damaging Het
Samd14 T C 11: 94,912,409 (GRCm39) S233P probably damaging Het
Sema6a C A 18: 47,433,195 (GRCm39) V79F probably damaging Het
Setbp1 A G 18: 78,900,697 (GRCm39) I990T probably damaging Het
Setx A G 2: 29,070,093 (GRCm39) R2633G probably benign Het
Siae T G 9: 37,557,816 (GRCm39) I541S possibly damaging Het
Slc13a1 A G 6: 24,103,428 (GRCm39) S372P possibly damaging Het
Smarcc2 T C 10: 128,297,342 (GRCm39) probably null Het
Snrpf T C 10: 93,423,985 (GRCm39) S2G probably benign Het
Speer2 C A 16: 69,655,708 (GRCm39) K39N probably null Het
Spink5 T G 18: 44,119,490 (GRCm39) F267C probably damaging Het
Tgfbrap1 G T 1: 43,114,666 (GRCm39) R145S probably damaging Het
Tmem161b C A 13: 84,442,887 (GRCm39) T269K possibly damaging Het
Tmem64 T C 4: 15,281,119 (GRCm39) I304T probably damaging Het
Tomm7 A G 5: 24,049,004 (GRCm39) I23T probably benign Het
Top6bl T A 19: 4,708,449 (GRCm39) S194C probably damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ttr C T 18: 20,803,167 (GRCm39) A111V possibly damaging Het
Usp47 T A 7: 111,683,089 (GRCm39) Y561N probably damaging Het
Vmn1r17 A G 6: 57,337,828 (GRCm39) V130A probably benign Het
Wdr45b A G 11: 121,219,621 (GRCm39) I309T probably benign Het
Wnt6 T C 1: 74,823,755 (GRCm39) L364P probably damaging Het
Zfp933 A G 4: 147,911,321 (GRCm39) W60R probably benign Het
Other mutations in Zc3h13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Zc3h13 APN 14 75,567,587 (GRCm39) missense probably damaging 0.99
IGL01129:Zc3h13 APN 14 75,573,439 (GRCm39) missense probably damaging 1.00
IGL01599:Zc3h13 APN 14 75,547,163 (GRCm39) missense probably damaging 1.00
IGL01844:Zc3h13 APN 14 75,581,209 (GRCm39) utr 3 prime probably benign
IGL02132:Zc3h13 APN 14 75,567,787 (GRCm39) missense probably benign 0.10
IGL03108:Zc3h13 APN 14 75,569,206 (GRCm39) missense possibly damaging 0.73
IGL03299:Zc3h13 APN 14 75,531,381 (GRCm39) missense probably damaging 1.00
IGL03377:Zc3h13 APN 14 75,531,416 (GRCm39) missense possibly damaging 0.53
B5639:Zc3h13 UTSW 14 75,553,479 (GRCm39) missense probably damaging 1.00
FR4304:Zc3h13 UTSW 14 75,561,050 (GRCm39) small insertion probably benign
FR4304:Zc3h13 UTSW 14 75,561,043 (GRCm39) small insertion probably benign
FR4340:Zc3h13 UTSW 14 75,561,032 (GRCm39) small insertion probably benign
FR4449:Zc3h13 UTSW 14 75,561,041 (GRCm39) nonsense probably null
FR4548:Zc3h13 UTSW 14 75,561,039 (GRCm39) small insertion probably benign
FR4589:Zc3h13 UTSW 14 75,561,038 (GRCm39) small insertion probably benign
FR4589:Zc3h13 UTSW 14 75,561,032 (GRCm39) small insertion probably benign
FR4589:Zc3h13 UTSW 14 75,561,037 (GRCm39) small insertion probably benign
FR4737:Zc3h13 UTSW 14 75,561,039 (GRCm39) small insertion probably benign
FR4737:Zc3h13 UTSW 14 75,561,036 (GRCm39) small insertion probably benign
PIT4696001:Zc3h13 UTSW 14 75,569,323 (GRCm39) missense probably damaging 1.00
R0103:Zc3h13 UTSW 14 75,567,908 (GRCm39) missense probably damaging 0.98
R0103:Zc3h13 UTSW 14 75,567,908 (GRCm39) missense probably damaging 0.98
R0127:Zc3h13 UTSW 14 75,560,694 (GRCm39) missense unknown
R0374:Zc3h13 UTSW 14 75,546,405 (GRCm39) missense probably damaging 1.00
R0396:Zc3h13 UTSW 14 75,560,922 (GRCm39) missense unknown
R0408:Zc3h13 UTSW 14 75,529,626 (GRCm39) nonsense probably null
R0967:Zc3h13 UTSW 14 75,581,179 (GRCm39) missense possibly damaging 0.54
R1006:Zc3h13 UTSW 14 75,567,989 (GRCm39) missense probably damaging 0.99
R1142:Zc3h13 UTSW 14 75,553,424 (GRCm39) missense probably benign 0.14
R1605:Zc3h13 UTSW 14 75,574,923 (GRCm39) nonsense probably null
R2021:Zc3h13 UTSW 14 75,567,635 (GRCm39) missense probably damaging 0.96
R2270:Zc3h13 UTSW 14 75,569,587 (GRCm39) missense probably benign 0.03
R3508:Zc3h13 UTSW 14 75,546,380 (GRCm39) nonsense probably null
R3745:Zc3h13 UTSW 14 75,568,101 (GRCm39) missense probably benign 0.03
R3954:Zc3h13 UTSW 14 75,567,178 (GRCm39) missense possibly damaging 0.85
R4205:Zc3h13 UTSW 14 75,565,041 (GRCm39) missense unknown
R4799:Zc3h13 UTSW 14 75,576,863 (GRCm39) missense probably damaging 1.00
R5042:Zc3h13 UTSW 14 75,576,836 (GRCm39) missense probably damaging 0.98
R5384:Zc3h13 UTSW 14 75,581,059 (GRCm39) missense probably benign 0.14
R5432:Zc3h13 UTSW 14 75,568,687 (GRCm39) missense probably damaging 1.00
R5611:Zc3h13 UTSW 14 75,568,348 (GRCm39) missense probably benign 0.10
R5687:Zc3h13 UTSW 14 75,569,400 (GRCm39) nonsense probably null
R5726:Zc3h13 UTSW 14 75,568,269 (GRCm39) missense possibly damaging 0.84
R5817:Zc3h13 UTSW 14 75,565,572 (GRCm39) missense probably damaging 0.96
R6087:Zc3h13 UTSW 14 75,568,149 (GRCm39) missense probably damaging 0.96
R6224:Zc3h13 UTSW 14 75,574,849 (GRCm39) missense probably damaging 0.99
R6247:Zc3h13 UTSW 14 75,581,176 (GRCm39) missense probably benign 0.14
R6278:Zc3h13 UTSW 14 75,567,863 (GRCm39) missense probably benign 0.01
R6315:Zc3h13 UTSW 14 75,546,355 (GRCm39) missense probably damaging 1.00
R6490:Zc3h13 UTSW 14 75,560,998 (GRCm39) small deletion probably benign
R6598:Zc3h13 UTSW 14 75,569,623 (GRCm39) missense probably damaging 0.99
R7051:Zc3h13 UTSW 14 75,568,597 (GRCm39) missense probably damaging 1.00
R7054:Zc3h13 UTSW 14 75,559,227 (GRCm39) missense probably benign 0.19
R7135:Zc3h13 UTSW 14 75,559,161 (GRCm39) missense unknown
R7307:Zc3h13 UTSW 14 75,567,981 (GRCm39) missense probably damaging 0.96
R7515:Zc3h13 UTSW 14 75,546,349 (GRCm39) missense unknown
R7680:Zc3h13 UTSW 14 75,567,955 (GRCm39) missense probably damaging 0.99
R8031:Zc3h13 UTSW 14 75,568,070 (GRCm39) missense not run
R8048:Zc3h13 UTSW 14 75,561,977 (GRCm39) missense unknown
R8059:Zc3h13 UTSW 14 75,565,250 (GRCm39) missense unknown
R8362:Zc3h13 UTSW 14 75,561,909 (GRCm39) missense unknown
R8391:Zc3h13 UTSW 14 75,568,625 (GRCm39) missense probably damaging 1.00
R8724:Zc3h13 UTSW 14 75,569,512 (GRCm39) missense probably benign 0.05
R9081:Zc3h13 UTSW 14 75,569,381 (GRCm39) small deletion probably benign
R9082:Zc3h13 UTSW 14 75,569,381 (GRCm39) small deletion probably benign
R9101:Zc3h13 UTSW 14 75,561,042 (GRCm39) missense unknown
R9214:Zc3h13 UTSW 14 75,560,991 (GRCm39) missense unknown
R9308:Zc3h13 UTSW 14 75,565,418 (GRCm39) missense unknown
R9376:Zc3h13 UTSW 14 75,561,128 (GRCm39) missense unknown
R9618:Zc3h13 UTSW 14 75,567,542 (GRCm39) missense
R9665:Zc3h13 UTSW 14 75,567,989 (GRCm39) missense probably damaging 0.99
Z1177:Zc3h13 UTSW 14 75,565,505 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GCTTATTATTGTGCCCAGTGC -3'
(R):5'- TTAAGAATAGAGACGCACACACTG -3'

Sequencing Primer
(F):5'- GTGCCCAGTGCCTTTTAATTACAC -3'
(R):5'- CTTTTAATGGGAAGAGCTAAGTGCCC -3'
Posted On 2016-06-21