Incidental Mutation 'R5134:Olfr350'
ID 396003
Institutional Source Beutler Lab
Gene Symbol Olfr350
Ensembl Gene ENSMUSG00000050015
Gene Name olfactory receptor 350
Synonyms MOR136-13, GA_x6K02T2NLDC-33544602-33545540
MMRRC Submission 042722-MU
Accession Numbers

Genbank: NM_146627; MGI: 3030184

Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock # R5134 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 36846310-36851702 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36850476 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 143 (L143F)
Ref Sequence ENSEMBL: ENSMUSP00000149667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055130] [ENSMUST00000214457] [ENSMUST00000215100]
AlphaFold Q8VFP8
Predicted Effect probably benign
Transcript: ENSMUST00000055130
AA Change: L143F

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000053105
Gene: ENSMUSG00000050015
AA Change: L143F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.3e-61 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.3e-7 PFAM
Pfam:7tm_1 41 290 3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214457
AA Change: L143F

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000215100
AA Change: L143F

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.1296 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7420426K07Rik T C 9: 98,903,740 S153P probably benign Het
Adarb1 T A 10: 77,325,845 probably benign Het
Adrb3 A C 8: 27,227,770 M217R probably damaging Het
Ank2 A T 3: 126,963,445 N1054K possibly damaging Het
Aox4 A T 1: 58,236,676 D389V probably benign Het
Aph1a G T 3: 95,895,531 G148W probably damaging Het
Arsj A G 3: 126,438,154 D183G probably benign Het
Atg2b A G 12: 105,674,950 S76P probably damaging Het
Atxn7l1 C A 12: 33,372,876 N815K probably damaging Het
Cd3d A T 9: 44,984,998 E28D probably damaging Het
Cir1 G A 2: 73,284,503 R404* probably null Het
Cops8 A G 1: 90,611,002 D51G probably damaging Het
Csgalnact1 T C 8: 68,460,971 E194G probably benign Het
Cstf2t T A 19: 31,084,094 D343E probably damaging Het
Ddx23 A T 15: 98,650,770 D352E possibly damaging Het
Dhx34 G T 7: 16,218,250 A150D possibly damaging Het
Dnal4 A T 15: 79,763,565 V32E possibly damaging Het
Dvl3 G T 16: 20,524,607 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 C T 15: 54,899,330 R174H probably damaging Het
Eps15 G A 4: 109,366,530 probably benign Het
F10 T C 8: 13,055,698 V421A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fer1l6 A T 15: 58,640,154 D1490V probably damaging Het
Fsd1l A G 4: 53,647,766 K70E probably benign Het
Galnt12 G A 4: 47,113,818 A79T probably damaging Het
Galnt17 A T 5: 130,964,035 M347K probably damaging Het
Glyatl3 A G 17: 40,905,030 V195A probably benign Het
Gm10770 A T 2: 150,179,560 probably null Het
Gm5578 A T 6: 112,606,085 noncoding transcript Het
Grn C A 11: 102,430,554 probably benign Het
Gsk3b G A 16: 38,240,520 R418H probably damaging Het
Hspa12b A G 2: 131,139,508 E221G possibly damaging Het
Ighv1-50 T G 12: 115,120,033 Q22H probably benign Het
Ipcef1 A G 10: 6,919,950 I150T probably benign Het
Ipp T A 4: 116,515,457 F228I possibly damaging Het
Itgb7 A G 15: 102,217,407 C596R probably damaging Het
Kif27 T C 13: 58,291,090 D1219G possibly damaging Het
Lats1 T A 10: 7,691,811 D115E probably benign Het
Lpcat3 A G 6: 124,702,530 N331S probably benign Het
Lrpprc A T 17: 84,751,256 N725K probably benign Het
Lss T G 10: 76,546,236 probably benign Het
Mfsd6 T C 1: 52,708,356 Y450C possibly damaging Het
Mmp21 A T 7: 133,679,013 V76E probably benign Het
Mtmr11 A T 3: 96,169,907 Y527F probably damaging Het
Mum1 T C 10: 80,232,868 L282P probably benign Het
Nat10 A T 2: 103,743,293 F327I probably benign Het
Nfkbiz A T 16: 55,818,500 M199K probably damaging Het
Nuak1 A G 10: 84,374,350 Y625H probably benign Het
Odf1 A G 15: 38,226,149 T98A possibly damaging Het
Olfr1274-ps T A 2: 90,400,763 M34K probably benign Het
Olfr1513 T C 14: 52,349,791 N85S probably benign Het
Oprl1 T A 2: 181,718,610 I153N probably damaging Het
Osbpl8 T A 10: 111,288,693 D705E probably benign Het
Otud4 G A 8: 79,655,689 V176I probably damaging Het
Paics T C 5: 76,956,822 probably benign Het
Pax5 A G 4: 44,710,407 M1T probably null Het
Pck1 A T 2: 173,153,489 N34I probably benign Het
Pde8b T C 13: 95,086,742 I335V probably benign Het
Piezo2 A G 18: 63,074,620 V1440A probably damaging Het
Ptpre T A 7: 135,652,092 F83Y probably damaging Het
Rassf6 T A 5: 90,604,366 probably null Het
Rilp A T 11: 75,512,708 L325F probably damaging Het
Rpf1 A G 3: 146,506,538 L349S probably damaging Het
Rprd2 G C 3: 95,765,320 R924G probably benign Het
Rps6kc1 T A 1: 190,773,648 D1039V probably damaging Het
Rufy3 G A 5: 88,645,567 V579I probably benign Het
Serpinc1 A G 1: 160,997,570 probably null Het
Siae T G 9: 37,646,520 I541S possibly damaging Het
St14 T G 9: 31,095,583 D649A probably benign Het
Stab2 A G 10: 86,871,810 probably null Het
Sun3 T C 11: 9,038,287 T12A probably benign Het
Tdrd6 A G 17: 43,626,210 Y1316H probably damaging Het
Thbs3 CAGAAG CAG 3: 89,223,102 probably benign Het
Tmem161b C A 13: 84,294,768 T269K possibly damaging Het
Trav14-3 T A 14: 53,763,244 S17T unknown Het
Trmu T A 15: 85,896,355 probably null Het
Ttn T A 2: 76,707,242 T26454S possibly damaging Het
Ubr3 T C 2: 70,020,446 probably benign Het
Unc5b A T 10: 60,775,100 V376E probably benign Het
Usp3 T C 9: 66,542,532 S166G possibly damaging Het
Vldlr C A 19: 27,238,812 C344* probably null Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdfy3 A C 5: 101,944,103 Y457D probably damaging Het
Zbtb2 T C 10: 4,369,267 Y253C possibly damaging Het
Zfp687 A C 3: 95,010,386 F692V probably damaging Het
Zfp758 A G 17: 22,375,405 K291E probably damaging Het
Zfp799 A T 17: 32,820,441 C284S probably damaging Het
Zp1 C A 19: 10,920,562 C5F probably benign Het
Other mutations in Olfr350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Olfr350 APN 2 36850270 missense probably damaging 1.00
IGL01113:Olfr350 APN 2 36850619 missense probably damaging 1.00
IGL01393:Olfr350 APN 2 36850541 missense probably benign 0.01
IGL02302:Olfr350 APN 2 36850703 missense probably benign 0.02
IGL02316:Olfr350 APN 2 36850282 missense probably damaging 1.00
BB007:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
BB017:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
F6893:Olfr350 UTSW 2 36850807 missense probably benign 0.00
PIT4402001:Olfr350 UTSW 2 36850304 missense probably benign
R0312:Olfr350 UTSW 2 36850360 missense probably benign 0.01
R0525:Olfr350 UTSW 2 36850190 missense probably damaging 1.00
R0557:Olfr350 UTSW 2 36850748 missense possibly damaging 0.95
R0665:Olfr350 UTSW 2 36850190 missense probably damaging 1.00
R2019:Olfr350 UTSW 2 36850406 missense possibly damaging 0.95
R2107:Olfr350 UTSW 2 36850343 missense possibly damaging 0.54
R2108:Olfr350 UTSW 2 36850343 missense possibly damaging 0.54
R2848:Olfr350 UTSW 2 36850799 missense probably damaging 1.00
R3964:Olfr350 UTSW 2 36850717 missense probably benign 0.12
R4822:Olfr350 UTSW 2 36850876 missense probably benign 0.10
R4907:Olfr350 UTSW 2 36850258 missense probably benign 0.28
R5144:Olfr350 UTSW 2 36850144 missense probably benign
R5702:Olfr350 UTSW 2 36850934 missense probably damaging 1.00
R5727:Olfr350 UTSW 2 36850532 missense possibly damaging 0.80
R5786:Olfr350 UTSW 2 36850049 start codon destroyed probably null 0.98
R6179:Olfr350 UTSW 2 36850834 missense possibly damaging 0.59
R6862:Olfr350 UTSW 2 36850222 missense possibly damaging 0.95
R7258:Olfr350 UTSW 2 36850340 missense probably damaging 0.99
R7307:Olfr350 UTSW 2 36850125 missense probably benign 0.00
R7353:Olfr350 UTSW 2 36850069 missense probably benign
R7412:Olfr350 UTSW 2 36850466 missense probably benign 0.28
R7851:Olfr350 UTSW 2 36850416 nonsense probably null
R7930:Olfr350 UTSW 2 36850273 missense probably damaging 1.00
R8005:Olfr350 UTSW 2 36850144 missense probably benign
R8346:Olfr350 UTSW 2 36850339 missense probably benign 0.02
R8692:Olfr350 UTSW 2 36850084 missense probably benign 0.00
R9120:Olfr350 UTSW 2 36850131 nonsense probably null
R9318:Olfr350 UTSW 2 36850553 missense probably benign 0.12
Z1177:Olfr350 UTSW 2 36850239 missense probably damaging 0.99
Z1177:Olfr350 UTSW 2 36850925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTGTACCCAAGATGCTG -3'
(R):5'- GGCAGAGTAATGACTGTTGTACC -3'

Sequencing Primer
(F):5'- CTGTACCCAAGATGCTGAGGAATATG -3'
(R):5'- CAGAGTAATGACTGTTGTACCTACTG -3'
Posted On 2016-06-21