Mutagenetix > Incidental Mutations

Incidental Mutation 'R5134:Olfr350'

396003

Institutional Source

Beutler Lab

Gene Symbol

Olfr350

Ensembl Gene

ENSMUSG00000050015

Gene Name

olfactory receptor 350

Synonyms

MOR136-13, GA_x6K02T2NLDC-33544602-33545540

MMRRC Submission

042722-MU

Accession Numbers

Genbank: NM_146627; MGI: 3030184

Is this an essential gene?

Probably non essential (E-score: 0.175) question?

Stock #

R5134 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36846310-36851702 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 36850476 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 143 (L143F)

Ref Sequence

ENSEMBL: ENSMUSP00000149667 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055130] [ENSMUST00000214457] [ENSMUST00000215100]

AlphaFold

Q8VFP8

Predicted Effect

probably benign
Transcript: ENSMUST00000055130
AA Change: L143F

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000053105
Gene: ENSMUSG00000050015
AA Change: L143F

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	6.3e-61	PFAM
Pfam:7TM_GPCR_Srsx	35	305	1.3e-7	PFAM
Pfam:7tm_1	41	290	3e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000214457
AA Change: L143F

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

Predicted Effect

probably benign
Transcript: ENSMUST00000215100
AA Change: L143F

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

Meta Mutation Damage Score

0.1296

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.5%

Validation Efficiency

96% (100/104)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
7420426K07Rik	T	C	9: 98,903,740	S153P	probably benign	Het
Adarb1	T	A	10: 77,325,845		probably benign	Het
Adrb3	A	C	8: 27,227,770	M217R	probably damaging	Het
Ank2	A	T	3: 126,963,445	N1054K	possibly damaging	Het
Aox4	A	T	1: 58,236,676	D389V	probably benign	Het
Aph1a	G	T	3: 95,895,531	G148W	probably damaging	Het
Arsj	A	G	3: 126,438,154	D183G	probably benign	Het
Atg2b	A	G	12: 105,674,950	S76P	probably damaging	Het
Atxn7l1	C	A	12: 33,372,876	N815K	probably damaging	Het
Cd3d	A	T	9: 44,984,998	E28D	probably damaging	Het
Cir1	G	A	2: 73,284,503	R404*	probably null	Het
Cops8	A	G	1: 90,611,002	D51G	probably damaging	Het
Csgalnact1	T	C	8: 68,460,971	E194G	probably benign	Het
Cstf2t	T	A	19: 31,084,094	D343E	probably damaging	Het
Ddx23	A	T	15: 98,650,770	D352E	possibly damaging	Het
Dhx34	G	T	7: 16,218,250	A150D	possibly damaging	Het
Dnal4	A	T	15: 79,763,565	V32E	possibly damaging	Het
Dvl3	G	T	16: 20,524,607		probably benign	Het
Ehmt1	G	T	2: 24,877,497	P135T	probably damaging	Het
Enpp2	C	T	15: 54,899,330	R174H	probably damaging	Het
Eps15	G	A	4: 109,366,530		probably benign	Het
F10	T	C	8: 13,055,698	V421A	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fer1l6	A	T	15: 58,640,154	D1490V	probably damaging	Het
Fsd1l	A	G	4: 53,647,766	K70E	probably benign	Het
Galnt12	G	A	4: 47,113,818	A79T	probably damaging	Het
Galnt17	A	T	5: 130,964,035	M347K	probably damaging	Het
Glyatl3	A	G	17: 40,905,030	V195A	probably benign	Het
Gm10770	A	T	2: 150,179,560		probably null	Het
Gm5578	A	T	6: 112,606,085		noncoding transcript	Het
Grn	C	A	11: 102,430,554		probably benign	Het
Gsk3b	G	A	16: 38,240,520	R418H	probably damaging	Het
Hspa12b	A	G	2: 131,139,508	E221G	possibly damaging	Het
Ighv1-50	T	G	12: 115,120,033	Q22H	probably benign	Het
Ipcef1	A	G	10: 6,919,950	I150T	probably benign	Het
Ipp	T	A	4: 116,515,457	F228I	possibly damaging	Het
Itgb7	A	G	15: 102,217,407	C596R	probably damaging	Het
Kif27	T	C	13: 58,291,090	D1219G	possibly damaging	Het
Lats1	T	A	10: 7,691,811	D115E	probably benign	Het
Lpcat3	A	G	6: 124,702,530	N331S	probably benign	Het
Lrpprc	A	T	17: 84,751,256	N725K	probably benign	Het
Lss	T	G	10: 76,546,236		probably benign	Het
Mfsd6	T	C	1: 52,708,356	Y450C	possibly damaging	Het
Mmp21	A	T	7: 133,679,013	V76E	probably benign	Het
Mtmr11	A	T	3: 96,169,907	Y527F	probably damaging	Het
Mum1	T	C	10: 80,232,868	L282P	probably benign	Het
Nat10	A	T	2: 103,743,293	F327I	probably benign	Het
Nfkbiz	A	T	16: 55,818,500	M199K	probably damaging	Het
Nuak1	A	G	10: 84,374,350	Y625H	probably benign	Het
Odf1	A	G	15: 38,226,149	T98A	possibly damaging	Het
Olfr1274-ps	T	A	2: 90,400,763	M34K	probably benign	Het
Olfr1513	T	C	14: 52,349,791	N85S	probably benign	Het
Oprl1	T	A	2: 181,718,610	I153N	probably damaging	Het
Osbpl8	T	A	10: 111,288,693	D705E	probably benign	Het
Otud4	G	A	8: 79,655,689	V176I	probably damaging	Het
Paics	T	C	5: 76,956,822		probably benign	Het
Pax5	A	G	4: 44,710,407	M1T	probably null	Het
Pck1	A	T	2: 173,153,489	N34I	probably benign	Het
Pde8b	T	C	13: 95,086,742	I335V	probably benign	Het
Piezo2	A	G	18: 63,074,620	V1440A	probably damaging	Het
Ptpre	T	A	7: 135,652,092	F83Y	probably damaging	Het
Rassf6	T	A	5: 90,604,366		probably null	Het
Rilp	A	T	11: 75,512,708	L325F	probably damaging	Het
Rpf1	A	G	3: 146,506,538	L349S	probably damaging	Het
Rprd2	G	C	3: 95,765,320	R924G	probably benign	Het
Rps6kc1	T	A	1: 190,773,648	D1039V	probably damaging	Het
Rufy3	G	A	5: 88,645,567	V579I	probably benign	Het
Serpinc1	A	G	1: 160,997,570		probably null	Het
Siae	T	G	9: 37,646,520	I541S	possibly damaging	Het
St14	T	G	9: 31,095,583	D649A	probably benign	Het
Stab2	A	G	10: 86,871,810		probably null	Het
Sun3	T	C	11: 9,038,287	T12A	probably benign	Het
Tdrd6	A	G	17: 43,626,210	Y1316H	probably damaging	Het
Thbs3	CAGAAG	CAG	3: 89,223,102		probably benign	Het
Tmem161b	C	A	13: 84,294,768	T269K	possibly damaging	Het
Trav14-3	T	A	14: 53,763,244	S17T	unknown	Het
Trmu	T	A	15: 85,896,355		probably null	Het
Ttn	T	A	2: 76,707,242	T26454S	possibly damaging	Het
Ubr3	T	C	2: 70,020,446		probably benign	Het
Unc5b	A	T	10: 60,775,100	V376E	probably benign	Het
Usp3	T	C	9: 66,542,532	S166G	possibly damaging	Het
Vldlr	C	A	19: 27,238,812	C344*	probably null	Het
Vmn1r17	A	G	6: 57,360,843	V130A	probably benign	Het
Wdfy3	A	C	5: 101,944,103	Y457D	probably damaging	Het
Zbtb2	T	C	10: 4,369,267	Y253C	possibly damaging	Het
Zfp687	A	C	3: 95,010,386	F692V	probably damaging	Het
Zfp758	A	G	17: 22,375,405	K291E	probably damaging	Het
Zfp799	A	T	17: 32,820,441	C284S	probably damaging	Het
Zp1	C	A	19: 10,920,562	C5F	probably benign	Het

Other mutations in Olfr350

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01068:Olfr350	APN	2	36850270	missense	probably damaging	1.00
IGL01113:Olfr350	APN	2	36850619	missense	probably damaging	1.00
IGL01393:Olfr350	APN	2	36850541	missense	probably benign	0.01
IGL02302:Olfr350	APN	2	36850703	missense	probably benign	0.02
IGL02316:Olfr350	APN	2	36850282	missense	probably damaging	1.00
BB007:Olfr350	UTSW	2	36850273	missense	probably damaging	1.00
BB017:Olfr350	UTSW	2	36850273	missense	probably damaging	1.00
F6893:Olfr350	UTSW	2	36850807	missense	probably benign	0.00
PIT4402001:Olfr350	UTSW	2	36850304	missense	probably benign
R0312:Olfr350	UTSW	2	36850360	missense	probably benign	0.01
R0525:Olfr350	UTSW	2	36850190	missense	probably damaging	1.00
R0557:Olfr350	UTSW	2	36850748	missense	possibly damaging	0.95
R0665:Olfr350	UTSW	2	36850190	missense	probably damaging	1.00
R2019:Olfr350	UTSW	2	36850406	missense	possibly damaging	0.95
R2107:Olfr350	UTSW	2	36850343	missense	possibly damaging	0.54
R2108:Olfr350	UTSW	2	36850343	missense	possibly damaging	0.54
R2848:Olfr350	UTSW	2	36850799	missense	probably damaging	1.00
R3964:Olfr350	UTSW	2	36850717	missense	probably benign	0.12
R4822:Olfr350	UTSW	2	36850876	missense	probably benign	0.10
R4907:Olfr350	UTSW	2	36850258	missense	probably benign	0.28
R5144:Olfr350	UTSW	2	36850144	missense	probably benign
R5702:Olfr350	UTSW	2	36850934	missense	probably damaging	1.00
R5727:Olfr350	UTSW	2	36850532	missense	possibly damaging	0.80
R5786:Olfr350	UTSW	2	36850049	start codon destroyed	probably null	0.98
R6179:Olfr350	UTSW	2	36850834	missense	possibly damaging	0.59
R6862:Olfr350	UTSW	2	36850222	missense	possibly damaging	0.95
R7258:Olfr350	UTSW	2	36850340	missense	probably damaging	0.99
R7307:Olfr350	UTSW	2	36850125	missense	probably benign	0.00
R7353:Olfr350	UTSW	2	36850069	missense	probably benign
R7412:Olfr350	UTSW	2	36850466	missense	probably benign	0.28
R7851:Olfr350	UTSW	2	36850416	nonsense	probably null
R7930:Olfr350	UTSW	2	36850273	missense	probably damaging	1.00
R8005:Olfr350	UTSW	2	36850144	missense	probably benign
R8346:Olfr350	UTSW	2	36850339	missense	probably benign	0.02
R8692:Olfr350	UTSW	2	36850084	missense	probably benign	0.00
R9120:Olfr350	UTSW	2	36850131	nonsense	probably null
R9318:Olfr350	UTSW	2	36850553	missense	probably benign	0.12
Z1177:Olfr350	UTSW	2	36850239	missense	probably damaging	0.99
Z1177:Olfr350	UTSW	2	36850925	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACTGTACCCAAGATGCTG -3'
(R):5'- GGCAGAGTAATGACTGTTGTACC -3'

Sequencing Primer
(F):5'- CTGTACCCAAGATGCTGAGGAATATG -3'
(R):5'- CAGAGTAATGACTGTTGTACCTACTG -3'

Posted On

2016-06-21