Incidental Mutation 'R5134:Pax5'
ID396024
Institutional Source Beutler Lab
Gene Symbol Pax5
Ensembl Gene ENSMUSG00000014030
Gene Namepaired box 5
SynonymsPax-5, EBB-1
MMRRC Submission 042722-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5134 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location44524757-44710487 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 44710407 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000133671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014174] [ENSMUST00000102932] [ENSMUST00000107825] [ENSMUST00000107826] [ENSMUST00000107827] [ENSMUST00000134968] [ENSMUST00000143235] [ENSMUST00000165417] [ENSMUST00000173733] [ENSMUST00000173821] [ENSMUST00000174242]
Predicted Effect probably null
Transcript: ENSMUST00000014174
AA Change: M1T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000014174
Gene: ENSMUSG00000014030
AA Change: M1T

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 1e-4 SMART
Pfam:Pax2_C 279 390 6e-53 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102932
AA Change: M1T

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099996
Gene: ENSMUSG00000014030
AA Change: M1T

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 1e-4 SMART
Pfam:Pax2_C 276 341 1.1e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107825
AA Change: M1T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000103455
Gene: ENSMUSG00000014030
AA Change: M1T

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 2e-4 SMART
Pfam:Pax2_C 279 356 5.7e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107826
AA Change: M1T

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103457
Gene: ENSMUSG00000014030
AA Change: M1T

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 7e-4 SMART
low complexity region 269 281 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107827
AA Change: M1T

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103458
Gene: ENSMUSG00000014030
AA Change: M1T

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 4e-4 SMART
low complexity region 298 310 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000134968
AA Change: M1T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000133540
Gene: ENSMUSG00000014030
AA Change: M1T

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
SCOP:d1ftt__ 177 211 1e-4 SMART
Pfam:Pax2_C 233 298 2.4e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000143235
AA Change: M1T

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000134370
Gene: ENSMUSG00000014030
AA Change: M1T

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 1e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000165417
AA Change: M1T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000128880
Gene: ENSMUSG00000014030
AA Change: M1T

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
SCOP:d1ftt__ 177 211 1e-4 SMART
Pfam:Pax2_C 233 347 7.3e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172866
SMART Domains Protein: ENSMUSP00000134119
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 4 85 2.44e-27 SMART
low complexity region 102 134 N/A INTRINSIC
SCOP:d1ftt__ 165 199 7e-5 SMART
Pfam:Pax2_C 224 335 2.3e-53 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173733
AA Change: M1T

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133671
Gene: ENSMUSG00000014030
AA Change: M1T

DomainStartEndE-ValueType
PAX 16 120 2.93e-30 SMART
SCOP:d1ftt__ 154 188 1e-4 SMART
Pfam:Pax2_C 212 290 8.7e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173821
AA Change: M1T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000134712
Gene: ENSMUSG00000014030
AA Change: M1T

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 2e-4 SMART
low complexity region 306 325 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174242
AA Change: M1T

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000134391
Gene: ENSMUSG00000014030
AA Change: M1T

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174319
SMART Domains Protein: ENSMUSP00000133978
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 4 85 2.44e-27 SMART
low complexity region 102 134 N/A INTRINSIC
SCOP:d1ftt__ 165 199 2e-4 SMART
low complexity region 251 270 N/A INTRINSIC
Meta Mutation Damage Score 0.9387 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the paired box (PAX) family of transcription factors. The central feature of this gene family is a novel, highly conserved DNA-binding motif, known as the paired box. Paired box transcription factors are important regulators in early development, and alterations in the expression of their genes are thought to contribute to neoplastic transformation. This gene encodes the B-cell lineage specific activator protein that is expressed at early, but not late stages of B-cell differentiation. Its expression has also been detected in developing CNS and testis and so the encoded protein may also play a role in neural development and spermatogenesis. This gene is located at 9p13, which is involved in t(9;14)(p13;q32) translocations recurring in small lymphocytic lymphomas of the plasmacytoid subtype, and in derived large-cell lymphomas. This translocation brings the potent E-mu enhancer of the IgH gene into close proximity of the PAX5 promoter, suggesting that the deregulation of transcription of this gene contributes to the pathogenesis of these lymphomas. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Null mutants exhibit impaired development of the midbrain resulting in a reduced inferior colliculus and an altered cerebellar folial pattern, failure of B cell differentiation, runting, and high postnatal mortality with few survivors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7420426K07Rik T C 9: 98,903,740 S153P probably benign Het
Adarb1 T A 10: 77,325,845 probably benign Het
Adrb3 A C 8: 27,227,770 M217R probably damaging Het
Ank2 A T 3: 126,963,445 N1054K possibly damaging Het
Aox4 A T 1: 58,236,676 D389V probably benign Het
Aph1a G T 3: 95,895,531 G148W probably damaging Het
Arsj A G 3: 126,438,154 D183G probably benign Het
Atg2b A G 12: 105,674,950 S76P probably damaging Het
Atxn7l1 C A 12: 33,372,876 N815K probably damaging Het
Cd3d A T 9: 44,984,998 E28D probably damaging Het
Cir1 G A 2: 73,284,503 R404* probably null Het
Cops8 A G 1: 90,611,002 D51G probably damaging Het
Csgalnact1 T C 8: 68,460,971 E194G probably benign Het
Cstf2t T A 19: 31,084,094 D343E probably damaging Het
Ddx23 A T 15: 98,650,770 D352E possibly damaging Het
Dhx34 G T 7: 16,218,250 A150D possibly damaging Het
Dnal4 A T 15: 79,763,565 V32E possibly damaging Het
Dvl3 G T 16: 20,524,607 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 C T 15: 54,899,330 R174H probably damaging Het
Eps15 G A 4: 109,366,530 probably benign Het
F10 T C 8: 13,055,698 V421A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fer1l6 A T 15: 58,640,154 D1490V probably damaging Het
Fsd1l A G 4: 53,647,766 K70E probably benign Het
Galnt12 G A 4: 47,113,818 A79T probably damaging Het
Galnt17 A T 5: 130,964,035 M347K probably damaging Het
Glyatl3 A G 17: 40,905,030 V195A probably benign Het
Gm10770 A T 2: 150,179,560 probably null Het
Gm5578 A T 6: 112,606,085 noncoding transcript Het
Grn C A 11: 102,430,554 probably benign Het
Gsk3b G A 16: 38,240,520 R418H probably damaging Het
Hspa12b A G 2: 131,139,508 E221G possibly damaging Het
Ighv1-50 T G 12: 115,120,033 Q22H probably benign Het
Ipcef1 A G 10: 6,919,950 I150T probably benign Het
Ipp T A 4: 116,515,457 F228I possibly damaging Het
Itgb7 A G 15: 102,217,407 C596R probably damaging Het
Kif27 T C 13: 58,291,090 D1219G possibly damaging Het
Lats1 T A 10: 7,691,811 D115E probably benign Het
Lpcat3 A G 6: 124,702,530 N331S probably benign Het
Lrpprc A T 17: 84,751,256 N725K probably benign Het
Lss T G 10: 76,546,236 probably benign Het
Mfsd6 T C 1: 52,708,356 Y450C possibly damaging Het
Mmp21 A T 7: 133,679,013 V76E probably benign Het
Mtmr11 A T 3: 96,169,907 Y527F probably damaging Het
Mum1 T C 10: 80,232,868 L282P probably benign Het
Nat10 A T 2: 103,743,293 F327I probably benign Het
Nfkbiz A T 16: 55,818,500 M199K probably damaging Het
Nuak1 A G 10: 84,374,350 Y625H probably benign Het
Odf1 A G 15: 38,226,149 T98A possibly damaging Het
Olfr1274-ps T A 2: 90,400,763 M34K probably benign Het
Olfr1513 T C 14: 52,349,791 N85S probably benign Het
Olfr350 A T 2: 36,850,476 L143F probably benign Het
Oprl1 T A 2: 181,718,610 I153N probably damaging Het
Osbpl8 T A 10: 111,288,693 D705E probably benign Het
Otud4 G A 8: 79,655,689 V176I probably damaging Het
Paics T C 5: 76,956,822 probably benign Het
Pck1 A T 2: 173,153,489 N34I probably benign Het
Pde8b T C 13: 95,086,742 I335V probably benign Het
Piezo2 A G 18: 63,074,620 V1440A probably damaging Het
Ptpre T A 7: 135,652,092 F83Y probably damaging Het
Rassf6 T A 5: 90,604,366 probably null Het
Rilp A T 11: 75,512,708 L325F probably damaging Het
Rpf1 A G 3: 146,506,538 L349S probably damaging Het
Rprd2 G C 3: 95,765,320 R924G probably benign Het
Rps6kc1 T A 1: 190,773,648 D1039V probably damaging Het
Rufy3 G A 5: 88,645,567 V579I probably benign Het
Serpinc1 A G 1: 160,997,570 probably null Het
Siae T G 9: 37,646,520 I541S possibly damaging Het
St14 T G 9: 31,095,583 D649A probably benign Het
Stab2 A G 10: 86,871,810 probably null Het
Sun3 T C 11: 9,038,287 T12A probably benign Het
Tdrd6 A G 17: 43,626,210 Y1316H probably damaging Het
Thbs3 CAGAAG CAG 3: 89,223,102 probably benign Het
Tmem161b C A 13: 84,294,768 T269K possibly damaging Het
Trav14-3 T A 14: 53,763,244 S17T unknown Het
Trmu T A 15: 85,896,355 probably null Het
Ttn T A 2: 76,707,242 T26454S possibly damaging Het
Ubr3 T C 2: 70,020,446 probably benign Het
Unc5b A T 10: 60,775,100 V376E probably benign Het
Usp3 T C 9: 66,542,532 S166G possibly damaging Het
Vldlr C A 19: 27,238,812 C344* probably null Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdfy3 A C 5: 101,944,103 Y457D probably damaging Het
Zbtb2 T C 10: 4,369,267 Y253C possibly damaging Het
Zfp687 A C 3: 95,010,386 F692V probably damaging Het
Zfp758 A G 17: 22,375,405 K291E probably damaging Het
Zfp799 A T 17: 32,820,441 C284S probably damaging Het
Zp1 C A 19: 10,920,562 C5F probably benign Het
Other mutations in Pax5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02369:Pax5 APN 4 44691919 missense probably damaging 1.00
IGL02700:Pax5 APN 4 44682722 missense probably damaging 0.99
IGL02754:Pax5 APN 4 44570059 missense probably damaging 0.96
apple UTSW 4 unclassified
Glacier UTSW 4 44679494 missense probably damaging 1.00
glacier2 UTSW 4 44710407 start codon destroyed probably null 0.96
Glacier3 UTSW 4 44679526 missense probably damaging 1.00
k2 UTSW 4 44697630 missense probably damaging 1.00
menshevik UTSW 4 44570071 missense probably damaging 1.00
Son_of_apple UTSW 4 44710583 unclassified probably benign
R0411:Pax5 UTSW 4 44609783 missense probably damaging 0.99
R0415:Pax5 UTSW 4 44691886 missense probably damaging 1.00
R0655:Pax5 UTSW 4 44537462 missense probably damaging 0.97
R1146:Pax5 UTSW 4 44697512 splice site probably benign
R1752:Pax5 UTSW 4 44609729 missense probably damaging 1.00
R1891:Pax5 UTSW 4 44691859 missense probably damaging 1.00
R4766:Pax5 UTSW 4 44679494 missense probably damaging 1.00
R4783:Pax5 UTSW 4 44570086 missense probably damaging 1.00
R5341:Pax5 UTSW 4 44697630 missense probably damaging 1.00
R5458:Pax5 UTSW 4 44679526 missense probably damaging 1.00
R6281:Pax5 UTSW 4 44691955 missense probably benign 0.37
R6871:Pax5 UTSW 4 44710583 unclassified probably benign
R7025:Pax5 UTSW 4 44679501 nonsense probably null
R7204:Pax5 UTSW 4 44679485 missense possibly damaging 0.93
R7975:Pax5 UTSW 4 44537465 missense probably damaging 0.98
R8246:Pax5 UTSW 4 44570027 missense probably benign 0.08
R8527:Pax5 UTSW 4 44570071 missense probably damaging 1.00
R8542:Pax5 UTSW 4 44570071 missense probably damaging 1.00
S24628:Pax5 UTSW 4 44691886 missense probably damaging 1.00
X0018:Pax5 UTSW 4 44691880 missense probably damaging 1.00
Z1176:Pax5 UTSW 4 44697678 missense probably damaging 1.00
Z1177:Pax5 UTSW 4 44697558 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACGCACTGTAGAAGGAC -3'
(R):5'- TTATTCCGACTTGTGAGCGG -3'

Sequencing Primer
(F):5'- GGCCTTTTCCTGAGAAAACTAC -3'
(R):5'- TTGTGAGCGGGCCCCAG -3'
Posted On2016-06-21