Incidental Mutation 'R5134:Eps15'
ID396028
Institutional Source Beutler Lab
Gene Symbol Eps15
Ensembl Gene ENSMUSG00000028552
Gene Nameepidermal growth factor receptor pathway substrate 15
Synonyms
MMRRC Submission 042722-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5134 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location109280268-109387817 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 109366530 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030281] [ENSMUST00000102729] [ENSMUST00000132165] [ENSMUST00000175776] [ENSMUST00000176251]
Predicted Effect probably benign
Transcript: ENSMUST00000030281
SMART Domains Protein: ENSMUSP00000030281
Gene: ENSMUSG00000028552

DomainStartEndE-ValueType
SCOP:d1bg1a1 37 178 8e-8 SMART
low complexity region 191 202 N/A INTRINSIC
internal_repeat_1 308 341 5.7e-7 PROSPERO
low complexity region 348 371 N/A INTRINSIC
low complexity region 430 440 N/A INTRINSIC
low complexity region 460 478 N/A INTRINSIC
internal_repeat_1 485 517 5.7e-7 PROSPERO
UIM 538 557 3.32e0 SMART
UIM 564 583 1.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102729
SMART Domains Protein: ENSMUSP00000099790
Gene: ENSMUSG00000028552

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 502 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
internal_repeat_2 622 655 1.25e-5 PROSPERO
low complexity region 662 685 N/A INTRINSIC
low complexity region 744 754 N/A INTRINSIC
low complexity region 774 792 N/A INTRINSIC
internal_repeat_2 799 831 1.25e-5 PROSPERO
UIM 852 871 3.32e0 SMART
UIM 878 897 1.55e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126015
Predicted Effect probably benign
Transcript: ENSMUST00000132165
SMART Domains Protein: ENSMUSP00000118949
Gene: ENSMUSG00000028552

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 429 N/A INTRINSIC
low complexity region 529 552 N/A INTRINSIC
low complexity region 611 621 N/A INTRINSIC
low complexity region 641 659 N/A INTRINSIC
UIM 719 738 3.32e0 SMART
UIM 745 764 1.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175776
SMART Domains Protein: ENSMUSP00000135270
Gene: ENSMUSG00000028552

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 253 349 4.38e-48 SMART
EFh 263 291 1.2e1 SMART
EFh 297 325 6.82e1 SMART
coiled coil region 365 538 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
internal_repeat_2 658 691 1.92e-5 PROSPERO
low complexity region 698 721 N/A INTRINSIC
low complexity region 780 790 N/A INTRINSIC
low complexity region 810 828 N/A INTRINSIC
internal_repeat_2 835 867 1.92e-5 PROSPERO
UIM 888 907 3.32e0 SMART
UIM 914 933 1.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176251
SMART Domains Protein: ENSMUSP00000135034
Gene: ENSMUSG00000028552

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 502 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
low complexity region 662 685 N/A INTRINSIC
low complexity region 744 754 N/A INTRINSIC
low complexity region 774 791 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177140
Predicted Effect probably benign
Transcript: ENSMUST00000177192
Meta Mutation Damage Score 0.0884 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of the EGFR pathway. The protein is present at clatherin-coated pits and is involved in receptor-mediated endocytosis of EGF. Notably, this gene is rearranged with the HRX/ALL/MLL gene in acute myelogeneous leukemias. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for a null allele show increased marginal zone B cell number with no changes in precursor cells, proliferation, apoptosis, migration or B cell responses. Homozygotes for a different null allele show decreased mean corpuscular hemoglobin (MCH), decreased MCH concentration, and dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7420426K07Rik T C 9: 98,903,740 S153P probably benign Het
Adarb1 T A 10: 77,325,845 probably benign Het
Adrb3 A C 8: 27,227,770 M217R probably damaging Het
Ank2 A T 3: 126,963,445 N1054K possibly damaging Het
Aox4 A T 1: 58,236,676 D389V probably benign Het
Aph1a G T 3: 95,895,531 G148W probably damaging Het
Arsj A G 3: 126,438,154 D183G probably benign Het
Atg2b A G 12: 105,674,950 S76P probably damaging Het
Atxn7l1 C A 12: 33,372,876 N815K probably damaging Het
Cd3d A T 9: 44,984,998 E28D probably damaging Het
Cir1 G A 2: 73,284,503 R404* probably null Het
Cops8 A G 1: 90,611,002 D51G probably damaging Het
Csgalnact1 T C 8: 68,460,971 E194G probably benign Het
Cstf2t T A 19: 31,084,094 D343E probably damaging Het
Ddx23 A T 15: 98,650,770 D352E possibly damaging Het
Dhx34 G T 7: 16,218,250 A150D possibly damaging Het
Dnal4 A T 15: 79,763,565 V32E possibly damaging Het
Dvl3 G T 16: 20,524,607 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 C T 15: 54,899,330 R174H probably damaging Het
F10 T C 8: 13,055,698 V421A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fer1l6 A T 15: 58,640,154 D1490V probably damaging Het
Fsd1l A G 4: 53,647,766 K70E probably benign Het
Galnt12 G A 4: 47,113,818 A79T probably damaging Het
Galnt17 A T 5: 130,964,035 M347K probably damaging Het
Glyatl3 A G 17: 40,905,030 V195A probably benign Het
Gm10770 A T 2: 150,179,560 probably null Het
Gm5578 A T 6: 112,606,085 noncoding transcript Het
Grn C A 11: 102,430,554 probably benign Het
Gsk3b G A 16: 38,240,520 R418H probably damaging Het
Hspa12b A G 2: 131,139,508 E221G possibly damaging Het
Ighv1-50 T G 12: 115,120,033 Q22H probably benign Het
Ipcef1 A G 10: 6,919,950 I150T probably benign Het
Ipp T A 4: 116,515,457 F228I possibly damaging Het
Itgb7 A G 15: 102,217,407 C596R probably damaging Het
Kif27 T C 13: 58,291,090 D1219G possibly damaging Het
Lats1 T A 10: 7,691,811 D115E probably benign Het
Lpcat3 A G 6: 124,702,530 N331S probably benign Het
Lrpprc A T 17: 84,751,256 N725K probably benign Het
Lss T G 10: 76,546,236 probably benign Het
Mfsd6 T C 1: 52,708,356 Y450C possibly damaging Het
Mmp21 A T 7: 133,679,013 V76E probably benign Het
Mtmr11 A T 3: 96,169,907 Y527F probably damaging Het
Mum1 T C 10: 80,232,868 L282P probably benign Het
Nat10 A T 2: 103,743,293 F327I probably benign Het
Nfkbiz A T 16: 55,818,500 M199K probably damaging Het
Nuak1 A G 10: 84,374,350 Y625H probably benign Het
Odf1 A G 15: 38,226,149 T98A possibly damaging Het
Olfr1274-ps T A 2: 90,400,763 M34K probably benign Het
Olfr1513 T C 14: 52,349,791 N85S probably benign Het
Olfr350 A T 2: 36,850,476 L143F probably benign Het
Oprl1 T A 2: 181,718,610 I153N probably damaging Het
Osbpl8 T A 10: 111,288,693 D705E probably benign Het
Otud4 G A 8: 79,655,689 V176I probably damaging Het
Paics T C 5: 76,956,822 probably benign Het
Pax5 A G 4: 44,710,407 M1T probably null Het
Pck1 A T 2: 173,153,489 N34I probably benign Het
Pde8b T C 13: 95,086,742 I335V probably benign Het
Piezo2 A G 18: 63,074,620 V1440A probably damaging Het
Ptpre T A 7: 135,652,092 F83Y probably damaging Het
Rassf6 T A 5: 90,604,366 probably null Het
Rilp A T 11: 75,512,708 L325F probably damaging Het
Rpf1 A G 3: 146,506,538 L349S probably damaging Het
Rprd2 G C 3: 95,765,320 R924G probably benign Het
Rps6kc1 T A 1: 190,773,648 D1039V probably damaging Het
Rufy3 G A 5: 88,645,567 V579I probably benign Het
Serpinc1 A G 1: 160,997,570 probably null Het
Siae T G 9: 37,646,520 I541S possibly damaging Het
St14 T G 9: 31,095,583 D649A probably benign Het
Stab2 A G 10: 86,871,810 probably null Het
Sun3 T C 11: 9,038,287 T12A probably benign Het
Tdrd6 A G 17: 43,626,210 Y1316H probably damaging Het
Thbs3 CAGAAG CAG 3: 89,223,102 probably benign Het
Tmem161b C A 13: 84,294,768 T269K possibly damaging Het
Trav14-3 T A 14: 53,763,244 S17T unknown Het
Trmu T A 15: 85,896,355 probably null Het
Ttn T A 2: 76,707,242 T26454S possibly damaging Het
Ubr3 T C 2: 70,020,446 probably benign Het
Unc5b A T 10: 60,775,100 V376E probably benign Het
Usp3 T C 9: 66,542,532 S166G possibly damaging Het
Vldlr C A 19: 27,238,812 C344* probably null Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdfy3 A C 5: 101,944,103 Y457D probably damaging Het
Zbtb2 T C 10: 4,369,267 Y253C possibly damaging Het
Zfp687 A C 3: 95,010,386 F692V probably damaging Het
Zfp758 A G 17: 22,375,405 K291E probably damaging Het
Zfp799 A T 17: 32,820,441 C284S probably damaging Het
Zp1 C A 19: 10,920,562 C5F probably benign Het
Other mutations in Eps15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Eps15 APN 4 109309149 missense probably damaging 0.99
IGL01372:Eps15 APN 4 109322106 missense probably damaging 1.00
IGL01642:Eps15 APN 4 109366473 missense probably benign 0.00
IGL02207:Eps15 APN 4 109304748 splice site probably benign
IGL02394:Eps15 APN 4 109312965 missense probably damaging 1.00
IGL02755:Eps15 APN 4 109329698 missense probably benign 0.17
R0117:Eps15 UTSW 4 109382819 missense probably damaging 0.96
R0414:Eps15 UTSW 4 109366480 missense probably damaging 0.96
R0928:Eps15 UTSW 4 109312963 missense possibly damaging 0.95
R1545:Eps15 UTSW 4 109312329 missense probably benign 0.00
R1581:Eps15 UTSW 4 109363186 missense probably benign 0.15
R1627:Eps15 UTSW 4 109370557 missense probably damaging 1.00
R1756:Eps15 UTSW 4 109312918 nonsense probably null
R1799:Eps15 UTSW 4 109382837 missense probably damaging 1.00
R1906:Eps15 UTSW 4 109324201 missense possibly damaging 0.89
R1916:Eps15 UTSW 4 109368974 missense probably damaging 1.00
R2042:Eps15 UTSW 4 109304767 missense probably damaging 0.98
R2046:Eps15 UTSW 4 109370596 missense probably damaging 1.00
R2163:Eps15 UTSW 4 109370669 missense probably damaging 0.98
R2213:Eps15 UTSW 4 109361220 missense probably damaging 1.00
R2362:Eps15 UTSW 4 109361230 missense probably benign 0.06
R3151:Eps15 UTSW 4 109366222 missense probably benign 0.02
R3712:Eps15 UTSW 4 109309177 missense probably damaging 1.00
R3727:Eps15 UTSW 4 109370685 splice site probably benign
R4361:Eps15 UTSW 4 109380031 critical splice donor site probably null
R4381:Eps15 UTSW 4 109366530 unclassified probably benign
R4466:Eps15 UTSW 4 109366530 unclassified probably benign
R4740:Eps15 UTSW 4 109343190 missense probably damaging 1.00
R4797:Eps15 UTSW 4 109366530 unclassified probably benign
R4799:Eps15 UTSW 4 109366530 unclassified probably benign
R4801:Eps15 UTSW 4 109324217 missense possibly damaging 0.95
R4802:Eps15 UTSW 4 109324217 missense possibly damaging 0.95
R4864:Eps15 UTSW 4 109366530 unclassified probably benign
R4954:Eps15 UTSW 4 109370678 splice site probably null
R5386:Eps15 UTSW 4 109321225 missense possibly damaging 0.48
R5768:Eps15 UTSW 4 109363176 splice site probably null
R5870:Eps15 UTSW 4 109361310 missense probably damaging 0.98
R6245:Eps15 UTSW 4 109382866 missense possibly damaging 0.66
R6290:Eps15 UTSW 4 109363198 missense probably benign 0.37
R6291:Eps15 UTSW 4 109305703 frame shift probably null
R6493:Eps15 UTSW 4 109368948 missense probably damaging 1.00
R6813:Eps15 UTSW 4 109280402 utr 5 prime probably null
R6885:Eps15 UTSW 4 109309164 missense probably damaging 0.99
R6913:Eps15 UTSW 4 109361230 missense probably benign 0.06
R7362:Eps15 UTSW 4 109366242 critical splice donor site probably null
R7461:Eps15 UTSW 4 109329725 missense probably damaging 1.00
X0023:Eps15 UTSW 4 109343357 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGTCACTTGAAGTACTTCTCTAAACG -3'
(R):5'- TGTGCAATCTCTATCACTGGC -3'

Sequencing Primer
(F):5'- CTTGAAGTACTTCTCTAAACGTTTGG -3'
(R):5'- GCCTTTACTCTGAAGAAACATTCTC -3'
Posted On2016-06-21