Incidental Mutation 'R5134:Rassf6'
ID 396033
Institutional Source Beutler Lab
Gene Symbol Rassf6
Ensembl Gene ENSMUSG00000029370
Gene Name Ras association (RalGDS/AF-6) domain family member 6
Synonyms 1600016B17Rik
MMRRC Submission 042722-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # R5134 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 90750935-90788516 bp(-) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to A at 90752225 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031317] [ENSMUST00000031317] [ENSMUST00000031317] [ENSMUST00000031317] [ENSMUST00000202704] [ENSMUST00000202704] [ENSMUST00000202704] [ENSMUST00000202704] [ENSMUST00000202784] [ENSMUST00000202784] [ENSMUST00000202784] [ENSMUST00000202784]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000031317
SMART Domains Protein: ENSMUSP00000031317
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000031317
SMART Domains Protein: ENSMUSP00000031317
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000031317
SMART Domains Protein: ENSMUSP00000031317
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000031317
SMART Domains Protein: ENSMUSP00000031317
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000202704
SMART Domains Protein: ENSMUSP00000144532
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000202704
SMART Domains Protein: ENSMUSP00000144532
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000202704
SMART Domains Protein: ENSMUSP00000144532
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000202704
SMART Domains Protein: ENSMUSP00000144532
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
RA 188 278 2.67e-9 SMART
Pfam:Nore1-SARAH 290 329 1.1e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000202784
SMART Domains Protein: ENSMUSP00000144337
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
low complexity region 126 135 N/A INTRINSIC
RA 175 265 2.67e-9 SMART
Pfam:Nore1-SARAH 277 316 8.6e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000202784
SMART Domains Protein: ENSMUSP00000144337
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
low complexity region 126 135 N/A INTRINSIC
RA 175 265 2.67e-9 SMART
Pfam:Nore1-SARAH 277 316 8.6e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000202784
SMART Domains Protein: ENSMUSP00000144337
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
low complexity region 126 135 N/A INTRINSIC
RA 175 265 2.67e-9 SMART
Pfam:Nore1-SARAH 277 316 8.6e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000202784
SMART Domains Protein: ENSMUSP00000144337
Gene: ENSMUSG00000029370

DomainStartEndE-ValueType
low complexity region 126 135 N/A INTRINSIC
RA 175 265 2.67e-9 SMART
Pfam:Nore1-SARAH 277 316 8.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202807
Predicted Effect probably benign
Transcript: ENSMUST00000202807
Meta Mutation Damage Score 0.9488 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-association domain family (RASSF). Members of this family form the core of a highly conserved tumor suppressor network, the Salvador-Warts-Hippo (SWH) pathway. The protein encoded by this gene is a Ras effector protein that induces apoptosis. A genomic region containing this gene has been linked to susceptibility to viral bronchiolitis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 T A 10: 77,161,679 (GRCm39) probably benign Het
Adrb3 A C 8: 27,717,798 (GRCm39) M217R probably damaging Het
Ank2 A T 3: 126,757,094 (GRCm39) N1054K possibly damaging Het
Aox4 A T 1: 58,275,835 (GRCm39) D389V probably benign Het
Aph1a G T 3: 95,802,843 (GRCm39) G148W probably damaging Het
Arsj A G 3: 126,231,803 (GRCm39) D183G probably benign Het
Atg2b A G 12: 105,641,209 (GRCm39) S76P probably damaging Het
Atxn7l1 C A 12: 33,422,875 (GRCm39) N815K probably damaging Het
Cd3d A T 9: 44,896,296 (GRCm39) E28D probably damaging Het
Cir1 G A 2: 73,114,847 (GRCm39) R404* probably null Het
Cops8 A G 1: 90,538,724 (GRCm39) D51G probably damaging Het
Csgalnact1 T C 8: 68,913,623 (GRCm39) E194G probably benign Het
Cstf2t T A 19: 31,061,494 (GRCm39) D343E probably damaging Het
Ddx23 A T 15: 98,548,651 (GRCm39) D352E possibly damaging Het
Dhx34 G T 7: 15,952,175 (GRCm39) A150D possibly damaging Het
Dnal4 A T 15: 79,647,766 (GRCm39) V32E possibly damaging Het
Dvl3 G T 16: 20,343,357 (GRCm39) probably benign Het
Ehmt1 G T 2: 24,767,509 (GRCm39) P135T probably damaging Het
Enpp2 C T 15: 54,762,726 (GRCm39) R174H probably damaging Het
Eps15 G A 4: 109,223,727 (GRCm39) probably benign Het
F10 T C 8: 13,105,698 (GRCm39) V421A probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fer1l6 A T 15: 58,512,003 (GRCm39) D1490V probably damaging Het
Fsd1l A G 4: 53,647,766 (GRCm39) K70E probably benign Het
Galnt12 G A 4: 47,113,818 (GRCm39) A79T probably damaging Het
Galnt17 A T 5: 130,992,873 (GRCm39) M347K probably damaging Het
Glyatl3 A G 17: 41,215,921 (GRCm39) V195A probably benign Het
Gm10770 A T 2: 150,021,480 (GRCm39) probably null Het
Gm5578 A T 6: 112,583,046 (GRCm39) noncoding transcript Het
Grn C A 11: 102,321,380 (GRCm39) probably benign Het
Gsk3b G A 16: 38,060,882 (GRCm39) R418H probably damaging Het
Hspa12b A G 2: 130,981,428 (GRCm39) E221G possibly damaging Het
Ighv1-50 T G 12: 115,083,653 (GRCm39) Q22H probably benign Het
Ipcef1 A G 10: 6,869,950 (GRCm39) I150T probably benign Het
Ipp T A 4: 116,372,654 (GRCm39) F228I possibly damaging Het
Itgb7 A G 15: 102,125,842 (GRCm39) C596R probably damaging Het
Kif27 T C 13: 58,438,904 (GRCm39) D1219G possibly damaging Het
Lats1 T A 10: 7,567,575 (GRCm39) D115E probably benign Het
Lpcat3 A G 6: 124,679,493 (GRCm39) N331S probably benign Het
Lrpprc A T 17: 85,058,684 (GRCm39) N725K probably benign Het
Lss T G 10: 76,382,070 (GRCm39) probably benign Het
Mfsd6 T C 1: 52,747,515 (GRCm39) Y450C possibly damaging Het
Mmp21 A T 7: 133,280,742 (GRCm39) V76E probably benign Het
Mtmr11 A T 3: 96,077,223 (GRCm39) Y527F probably damaging Het
Nat10 A T 2: 103,573,638 (GRCm39) F327I probably benign Het
Nfkbiz A T 16: 55,638,863 (GRCm39) M199K probably damaging Het
Nuak1 A G 10: 84,210,214 (GRCm39) Y625H probably benign Het
Odf1 A G 15: 38,226,393 (GRCm39) T98A possibly damaging Het
Oprl1 T A 2: 181,360,403 (GRCm39) I153N probably damaging Het
Or10g3b T C 14: 52,587,248 (GRCm39) N85S probably benign Het
Or1j4 A T 2: 36,740,488 (GRCm39) L143F probably benign Het
Or4x13 T A 2: 90,231,107 (GRCm39) M34K probably benign Het
Osbpl8 T A 10: 111,124,554 (GRCm39) D705E probably benign Het
Otud4 G A 8: 80,382,318 (GRCm39) V176I probably damaging Het
Paics T C 5: 77,104,669 (GRCm39) probably benign Het
Pax5 A G 4: 44,710,407 (GRCm39) M1T probably null Het
Pck1 A T 2: 172,995,282 (GRCm39) N34I probably benign Het
Pde8b T C 13: 95,223,250 (GRCm39) I335V probably benign Het
Piezo2 A G 18: 63,207,691 (GRCm39) V1440A probably damaging Het
Prr23a4 T C 9: 98,785,793 (GRCm39) S153P probably benign Het
Ptpre T A 7: 135,253,821 (GRCm39) F83Y probably damaging Het
Pwwp3a T C 10: 80,068,702 (GRCm39) L282P probably benign Het
Rilp A T 11: 75,403,534 (GRCm39) L325F probably damaging Het
Rpf1 A G 3: 146,212,293 (GRCm39) L349S probably damaging Het
Rprd2 G C 3: 95,672,632 (GRCm39) R924G probably benign Het
Rps6kc1 T A 1: 190,505,845 (GRCm39) D1039V probably damaging Het
Rufy3 G A 5: 88,793,426 (GRCm39) V579I probably benign Het
Serpinc1 A G 1: 160,825,140 (GRCm39) probably null Het
Siae T G 9: 37,557,816 (GRCm39) I541S possibly damaging Het
St14 T G 9: 31,006,879 (GRCm39) D649A probably benign Het
Stab2 A G 10: 86,707,674 (GRCm39) probably null Het
Sun3 T C 11: 8,988,287 (GRCm39) T12A probably benign Het
Tdrd6 A G 17: 43,937,101 (GRCm39) Y1316H probably damaging Het
Thbs3 CAGAAG CAG 3: 89,130,409 (GRCm39) probably benign Het
Tmem161b C A 13: 84,442,887 (GRCm39) T269K possibly damaging Het
Trav14-3 T A 14: 54,000,701 (GRCm39) S17T unknown Het
Trmu T A 15: 85,780,556 (GRCm39) probably null Het
Ttn T A 2: 76,537,586 (GRCm39) T26454S possibly damaging Het
Ubr3 T C 2: 69,850,790 (GRCm39) probably benign Het
Unc5b A T 10: 60,610,879 (GRCm39) V376E probably benign Het
Usp3 T C 9: 66,449,814 (GRCm39) S166G possibly damaging Het
Vldlr C A 19: 27,216,212 (GRCm39) C344* probably null Het
Vmn1r17 A G 6: 57,337,828 (GRCm39) V130A probably benign Het
Wdfy3 A C 5: 102,091,969 (GRCm39) Y457D probably damaging Het
Zbtb2 T C 10: 4,319,267 (GRCm39) Y253C possibly damaging Het
Zfp687 A C 3: 94,917,697 (GRCm39) F692V probably damaging Het
Zfp758 A G 17: 22,594,386 (GRCm39) K291E probably damaging Het
Zfp799 A T 17: 33,039,415 (GRCm39) C284S probably damaging Het
Zp1 C A 19: 10,897,926 (GRCm39) C5F probably benign Het
Other mutations in Rassf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Rassf6 APN 5 90,751,999 (GRCm39) missense probably damaging 1.00
IGL00819:Rassf6 APN 5 90,751,930 (GRCm39) missense probably benign 0.03
IGL01139:Rassf6 APN 5 90,756,825 (GRCm39) makesense probably null
IGL03114:Rassf6 APN 5 90,756,649 (GRCm39) splice site probably benign
R1956:Rassf6 UTSW 5 90,763,730 (GRCm39) nonsense probably null
R2167:Rassf6 UTSW 5 90,751,797 (GRCm39) missense probably damaging 1.00
R2351:Rassf6 UTSW 5 90,779,418 (GRCm39) missense probably benign 0.05
R2877:Rassf6 UTSW 5 90,754,664 (GRCm39) missense probably damaging 1.00
R3943:Rassf6 UTSW 5 90,752,185 (GRCm39) missense possibly damaging 0.49
R3944:Rassf6 UTSW 5 90,752,185 (GRCm39) missense possibly damaging 0.49
R4131:Rassf6 UTSW 5 90,757,646 (GRCm39) missense probably damaging 1.00
R5153:Rassf6 UTSW 5 90,754,699 (GRCm39) missense possibly damaging 0.81
R5633:Rassf6 UTSW 5 90,751,977 (GRCm39) missense possibly damaging 0.84
R5994:Rassf6 UTSW 5 90,765,627 (GRCm39) missense probably damaging 1.00
R6000:Rassf6 UTSW 5 90,751,736 (GRCm39) missense probably damaging 1.00
R6746:Rassf6 UTSW 5 90,757,633 (GRCm39) missense possibly damaging 0.80
R7038:Rassf6 UTSW 5 90,757,584 (GRCm39) missense probably benign 0.13
R7190:Rassf6 UTSW 5 90,754,666 (GRCm39) missense probably damaging 1.00
R7549:Rassf6 UTSW 5 90,754,661 (GRCm39) missense probably damaging 1.00
R8497:Rassf6 UTSW 5 90,779,391 (GRCm39) missense possibly damaging 0.83
R9472:Rassf6 UTSW 5 90,765,572 (GRCm39) nonsense probably null
RF002:Rassf6 UTSW 5 90,756,784 (GRCm39) nonsense probably null
RF002:Rassf6 UTSW 5 90,756,780 (GRCm39) utr 3 prime probably benign
RF004:Rassf6 UTSW 5 90,756,778 (GRCm39) utr 3 prime probably benign
RF011:Rassf6 UTSW 5 90,756,780 (GRCm39) utr 3 prime probably benign
RF013:Rassf6 UTSW 5 90,756,800 (GRCm39) utr 3 prime probably benign
RF018:Rassf6 UTSW 5 90,756,788 (GRCm39) utr 3 prime probably benign
RF032:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,776 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,771 (GRCm39) utr 3 prime probably benign
RF034:Rassf6 UTSW 5 90,756,782 (GRCm39) utr 3 prime probably benign
RF035:Rassf6 UTSW 5 90,756,767 (GRCm39) utr 3 prime probably benign
RF036:Rassf6 UTSW 5 90,756,774 (GRCm39) utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90,756,789 (GRCm39) utr 3 prime probably benign
RF038:Rassf6 UTSW 5 90,756,783 (GRCm39) utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF039:Rassf6 UTSW 5 90,756,774 (GRCm39) utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90,756,798 (GRCm39) utr 3 prime probably benign
RF043:Rassf6 UTSW 5 90,756,791 (GRCm39) utr 3 prime probably benign
RF049:Rassf6 UTSW 5 90,756,772 (GRCm39) utr 3 prime probably benign
RF051:Rassf6 UTSW 5 90,756,788 (GRCm39) utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90,756,782 (GRCm39) utr 3 prime probably benign
RF052:Rassf6 UTSW 5 90,756,775 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,790 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,783 (GRCm39) utr 3 prime probably benign
RF054:Rassf6 UTSW 5 90,756,770 (GRCm39) utr 3 prime probably benign
RF063:Rassf6 UTSW 5 90,756,801 (GRCm39) nonsense probably null
X0017:Rassf6 UTSW 5 90,754,648 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGGTTAAGAAGCACCCTGTC -3'
(R):5'- AGAGTGTCACATGTTCCTTGGG -3'

Sequencing Primer
(F):5'- TTAAGAAGCACCCTGTCAGTGG -3'
(R):5'- GGTCTGGGAATGTATTCACCATG -3'
Posted On 2016-06-21