Incidental Mutation 'R5134:Csgalnact1'
ID396044
Institutional Source Beutler Lab
Gene Symbol Csgalnact1
Ensembl Gene ENSMUSG00000036356
Gene Namechondroitin sulfate N-acetylgalactosaminyltransferase 1
SynonymsCSGalNAcT-1, 4732435N03Rik
MMRRC Submission 042722-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5134 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location68356781-68735146 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68460971 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 194 (E194G)
Ref Sequence ENSEMBL: ENSMUSP00000116134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078350] [ENSMUST00000130214] [ENSMUST00000136060]
Predicted Effect probably benign
Transcript: ENSMUST00000078350
AA Change: E194G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000077459
Gene: ENSMUSG00000036356
AA Change: E194G

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:CHGN 55 505 3.5e-85 PFAM
Pfam:Glyco_tranf_2_2 263 478 3.2e-10 PFAM
Pfam:Glyco_transf_7C 409 478 1.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130214
AA Change: E194G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119817
Gene: ENSMUSG00000036356
AA Change: E194G

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:CHGN 71 505 1.1e-59 PFAM
Pfam:Glyco_tranf_2_2 263 478 3.6e-10 PFAM
Pfam:Glyco_transf_7C 405 478 3.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132076
Predicted Effect probably benign
Transcript: ENSMUST00000136060
AA Change: E194G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000116134
Gene: ENSMUSG00000036356
AA Change: E194G

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:CHGN 66 300 1.6e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211871
Meta Mutation Damage Score 0.0817 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 96% (100/104)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and length, short limbs, and abnormal cartilage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7420426K07Rik T C 9: 98,903,740 S153P probably benign Het
Adarb1 T A 10: 77,325,845 probably benign Het
Adrb3 A C 8: 27,227,770 M217R probably damaging Het
Ank2 A T 3: 126,963,445 N1054K possibly damaging Het
Aox4 A T 1: 58,236,676 D389V probably benign Het
Aph1a G T 3: 95,895,531 G148W probably damaging Het
Arsj A G 3: 126,438,154 D183G probably benign Het
Atg2b A G 12: 105,674,950 S76P probably damaging Het
Atxn7l1 C A 12: 33,372,876 N815K probably damaging Het
Cd3d A T 9: 44,984,998 E28D probably damaging Het
Cir1 G A 2: 73,284,503 R404* probably null Het
Cops8 A G 1: 90,611,002 D51G probably damaging Het
Cstf2t T A 19: 31,084,094 D343E probably damaging Het
Ddx23 A T 15: 98,650,770 D352E possibly damaging Het
Dhx34 G T 7: 16,218,250 A150D possibly damaging Het
Dnal4 A T 15: 79,763,565 V32E possibly damaging Het
Dvl3 G T 16: 20,524,607 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 C T 15: 54,899,330 R174H probably damaging Het
Eps15 G A 4: 109,366,530 probably benign Het
F10 T C 8: 13,055,698 V421A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fer1l6 A T 15: 58,640,154 D1490V probably damaging Het
Fsd1l A G 4: 53,647,766 K70E probably benign Het
Galnt12 G A 4: 47,113,818 A79T probably damaging Het
Galnt17 A T 5: 130,964,035 M347K probably damaging Het
Glyatl3 A G 17: 40,905,030 V195A probably benign Het
Gm10770 A T 2: 150,179,560 probably null Het
Gm5578 A T 6: 112,606,085 noncoding transcript Het
Grn C A 11: 102,430,554 probably benign Het
Gsk3b G A 16: 38,240,520 R418H probably damaging Het
Hspa12b A G 2: 131,139,508 E221G possibly damaging Het
Ighv1-50 T G 12: 115,120,033 Q22H probably benign Het
Ipcef1 A G 10: 6,919,950 I150T probably benign Het
Ipp T A 4: 116,515,457 F228I possibly damaging Het
Itgb7 A G 15: 102,217,407 C596R probably damaging Het
Kif27 T C 13: 58,291,090 D1219G possibly damaging Het
Lats1 T A 10: 7,691,811 D115E probably benign Het
Lpcat3 A G 6: 124,702,530 N331S probably benign Het
Lrpprc A T 17: 84,751,256 N725K probably benign Het
Lss T G 10: 76,546,236 probably benign Het
Mfsd6 T C 1: 52,708,356 Y450C possibly damaging Het
Mmp21 A T 7: 133,679,013 V76E probably benign Het
Mtmr11 A T 3: 96,169,907 Y527F probably damaging Het
Mum1 T C 10: 80,232,868 L282P probably benign Het
Nat10 A T 2: 103,743,293 F327I probably benign Het
Nfkbiz A T 16: 55,818,500 M199K probably damaging Het
Nuak1 A G 10: 84,374,350 Y625H probably benign Het
Odf1 A G 15: 38,226,149 T98A possibly damaging Het
Olfr1274-ps T A 2: 90,400,763 M34K probably benign Het
Olfr1513 T C 14: 52,349,791 N85S probably benign Het
Olfr350 A T 2: 36,850,476 L143F probably benign Het
Oprl1 T A 2: 181,718,610 I153N probably damaging Het
Osbpl8 T A 10: 111,288,693 D705E probably benign Het
Otud4 G A 8: 79,655,689 V176I probably damaging Het
Paics T C 5: 76,956,822 probably benign Het
Pax5 A G 4: 44,710,407 M1T probably null Het
Pck1 A T 2: 173,153,489 N34I probably benign Het
Pde8b T C 13: 95,086,742 I335V probably benign Het
Piezo2 A G 18: 63,074,620 V1440A probably damaging Het
Ptpre T A 7: 135,652,092 F83Y probably damaging Het
Rassf6 T A 5: 90,604,366 probably null Het
Rilp A T 11: 75,512,708 L325F probably damaging Het
Rpf1 A G 3: 146,506,538 L349S probably damaging Het
Rprd2 G C 3: 95,765,320 R924G probably benign Het
Rps6kc1 T A 1: 190,773,648 D1039V probably damaging Het
Rufy3 G A 5: 88,645,567 V579I probably benign Het
Serpinc1 A G 1: 160,997,570 probably null Het
Siae T G 9: 37,646,520 I541S possibly damaging Het
St14 T G 9: 31,095,583 D649A probably benign Het
Stab2 A G 10: 86,871,810 probably null Het
Sun3 T C 11: 9,038,287 T12A probably benign Het
Tdrd6 A G 17: 43,626,210 Y1316H probably damaging Het
Thbs3 CAGAAG CAG 3: 89,223,102 probably benign Het
Tmem161b C A 13: 84,294,768 T269K possibly damaging Het
Trav14-3 T A 14: 53,763,244 S17T unknown Het
Trmu T A 15: 85,896,355 probably null Het
Ttn T A 2: 76,707,242 T26454S possibly damaging Het
Ubr3 T C 2: 70,020,446 probably benign Het
Unc5b A T 10: 60,775,100 V376E probably benign Het
Usp3 T C 9: 66,542,532 S166G possibly damaging Het
Vldlr C A 19: 27,238,812 C344* probably null Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdfy3 A C 5: 101,944,103 Y457D probably damaging Het
Zbtb2 T C 10: 4,369,267 Y253C possibly damaging Het
Zfp687 A C 3: 95,010,386 F692V probably damaging Het
Zfp758 A G 17: 22,375,405 K291E probably damaging Het
Zfp799 A T 17: 32,820,441 C284S probably damaging Het
Zp1 C A 19: 10,920,562 C5F probably benign Het
Other mutations in Csgalnact1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02015:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02025:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02037:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02059:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02074:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02079:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02080:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02094:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02127:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02128:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02157:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02158:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02197:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02201:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02206:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02207:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02214:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02215:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02229:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02243:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02247:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02248:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02250:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02389:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02394:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02397:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02398:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02400:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02404:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02405:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02406:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02420:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02425:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02428:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02436:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02437:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02438:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02468:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02470:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02472:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02473:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02474:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02475:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02510:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02529:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02530:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02531:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02533:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02543:Csgalnact1 APN 8 68461068 missense probably damaging 1.00
IGL02620:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02625:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02671:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02674:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02683:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02685:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02686:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02697:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02698:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02741:Csgalnact1 APN 8 68401492 missense probably damaging 1.00
IGL02985:Csgalnact1 APN 8 68461043 missense probably benign 0.02
R0173:Csgalnact1 UTSW 8 68461029 missense probably damaging 1.00
R1594:Csgalnact1 UTSW 8 68358632 missense probably damaging 1.00
R1655:Csgalnact1 UTSW 8 68373689 missense possibly damaging 0.89
R1873:Csgalnact1 UTSW 8 68401384 missense probably benign 0.02
R1955:Csgalnact1 UTSW 8 68372667 missense probably benign
R2421:Csgalnact1 UTSW 8 68461508 missense probably benign 0.42
R3195:Csgalnact1 UTSW 8 68461085 frame shift probably null
R3196:Csgalnact1 UTSW 8 68461085 frame shift probably null
R3951:Csgalnact1 UTSW 8 68461262 missense probably benign
R4304:Csgalnact1 UTSW 8 68372642 missense possibly damaging 0.94
R4989:Csgalnact1 UTSW 8 68460971 missense probably benign 0.01
R5133:Csgalnact1 UTSW 8 68460971 missense probably benign 0.01
R5503:Csgalnact1 UTSW 8 68461473 missense probably damaging 0.98
R5812:Csgalnact1 UTSW 8 68401384 missense probably benign 0.02
R6143:Csgalnact1 UTSW 8 68373550 missense probably damaging 1.00
R6387:Csgalnact1 UTSW 8 68358713 missense probably damaging 1.00
R6476:Csgalnact1 UTSW 8 68461109 missense probably damaging 1.00
R6476:Csgalnact1 UTSW 8 68461110 missense probably damaging 1.00
R7023:Csgalnact1 UTSW 8 68358429 missense probably benign
R8318:Csgalnact1 UTSW 8 68461133 missense probably damaging 1.00
R8446:Csgalnact1 UTSW 8 68461091 missense probably damaging 0.99
R8519:Csgalnact1 UTSW 8 68401453 missense possibly damaging 0.65
R8674:Csgalnact1 UTSW 8 68373616 missense possibly damaging 0.91
R8782:Csgalnact1 UTSW 8 68358655 missense probably damaging 1.00
Z1088:Csgalnact1 UTSW 8 68401330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACATCTTTGGTGCCCC -3'
(R):5'- AGGTACATGCCGGTGTCAAG -3'

Sequencing Primer
(F):5'- ATCTTTGGTGCCCCTCATAAAAAC -3'
(R):5'- TCAAGCTGGCCACGGAGTATG -3'
Posted On2016-06-21