Mutagenetix > Incidental Mutation

Incidental Mutation 'R5134:Lats1'

396054

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

MMRRC Submission

042722-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.890) question?

Stock #

R5134 (G1)

Quality Score

201

Status

Validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 7691811 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 115 (D115E)

Ref Sequence

ENSEMBL: ENSMUSP00000151533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

probably benign
Transcript: ENSMUST00000040043
AA Change: D115E

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: D115E

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165952
AA Change: D115E

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: D115E

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000217931
AA Change: D115E

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)

Meta Mutation Damage Score

0.0820

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.5%

Validation Efficiency

96% (100/104)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
7420426K07Rik	T	C	9: 98,903,740	S153P	probably benign	Het
Adarb1	T	A	10: 77,325,845		probably benign	Het
Adrb3	A	C	8: 27,227,770	M217R	probably damaging	Het
Ank2	A	T	3: 126,963,445	N1054K	possibly damaging	Het
Aox4	A	T	1: 58,236,676	D389V	probably benign	Het
Aph1a	G	T	3: 95,895,531	G148W	probably damaging	Het
Arsj	A	G	3: 126,438,154	D183G	probably benign	Het
Atg2b	A	G	12: 105,674,950	S76P	probably damaging	Het
Atxn7l1	C	A	12: 33,372,876	N815K	probably damaging	Het
Cd3d	A	T	9: 44,984,998	E28D	probably damaging	Het
Cir1	G	A	2: 73,284,503	R404*	probably null	Het
Cops8	A	G	1: 90,611,002	D51G	probably damaging	Het
Csgalnact1	T	C	8: 68,460,971	E194G	probably benign	Het
Cstf2t	T	A	19: 31,084,094	D343E	probably damaging	Het
Ddx23	A	T	15: 98,650,770	D352E	possibly damaging	Het
Dhx34	G	T	7: 16,218,250	A150D	possibly damaging	Het
Dnal4	A	T	15: 79,763,565	V32E	possibly damaging	Het
Dvl3	G	T	16: 20,524,607		probably benign	Het
Ehmt1	G	T	2: 24,877,497	P135T	probably damaging	Het
Enpp2	C	T	15: 54,899,330	R174H	probably damaging	Het
Eps15	G	A	4: 109,366,530		probably benign	Het
F10	T	C	8: 13,055,698	V421A	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fer1l6	A	T	15: 58,640,154	D1490V	probably damaging	Het
Fsd1l	A	G	4: 53,647,766	K70E	probably benign	Het
Galnt12	G	A	4: 47,113,818	A79T	probably damaging	Het
Galnt17	A	T	5: 130,964,035	M347K	probably damaging	Het
Glyatl3	A	G	17: 40,905,030	V195A	probably benign	Het
Gm10770	A	T	2: 150,179,560		probably null	Het
Gm5578	A	T	6: 112,606,085		noncoding transcript	Het
Grn	C	A	11: 102,430,554		probably benign	Het
Gsk3b	G	A	16: 38,240,520	R418H	probably damaging	Het
Hspa12b	A	G	2: 131,139,508	E221G	possibly damaging	Het
Ighv1-50	T	G	12: 115,120,033	Q22H	probably benign	Het
Ipcef1	A	G	10: 6,919,950	I150T	probably benign	Het
Ipp	T	A	4: 116,515,457	F228I	possibly damaging	Het
Itgb7	A	G	15: 102,217,407	C596R	probably damaging	Het
Kif27	T	C	13: 58,291,090	D1219G	possibly damaging	Het
Lpcat3	A	G	6: 124,702,530	N331S	probably benign	Het
Lrpprc	A	T	17: 84,751,256	N725K	probably benign	Het
Lss	T	G	10: 76,546,236		probably benign	Het
Mfsd6	T	C	1: 52,708,356	Y450C	possibly damaging	Het
Mmp21	A	T	7: 133,679,013	V76E	probably benign	Het
Mtmr11	A	T	3: 96,169,907	Y527F	probably damaging	Het
Mum1	T	C	10: 80,232,868	L282P	probably benign	Het
Nat10	A	T	2: 103,743,293	F327I	probably benign	Het
Nfkbiz	A	T	16: 55,818,500	M199K	probably damaging	Het
Nuak1	A	G	10: 84,374,350	Y625H	probably benign	Het
Odf1	A	G	15: 38,226,149	T98A	possibly damaging	Het
Olfr1274-ps	T	A	2: 90,400,763	M34K	probably benign	Het
Olfr1513	T	C	14: 52,349,791	N85S	probably benign	Het
Olfr350	A	T	2: 36,850,476	L143F	probably benign	Het
Oprl1	T	A	2: 181,718,610	I153N	probably damaging	Het
Osbpl8	T	A	10: 111,288,693	D705E	probably benign	Het
Otud4	G	A	8: 79,655,689	V176I	probably damaging	Het
Paics	T	C	5: 76,956,822		probably benign	Het
Pax5	A	G	4: 44,710,407	M1T	probably null	Het
Pck1	A	T	2: 173,153,489	N34I	probably benign	Het
Pde8b	T	C	13: 95,086,742	I335V	probably benign	Het
Piezo2	A	G	18: 63,074,620	V1440A	probably damaging	Het
Ptpre	T	A	7: 135,652,092	F83Y	probably damaging	Het
Rassf6	T	A	5: 90,604,366		probably null	Het
Rilp	A	T	11: 75,512,708	L325F	probably damaging	Het
Rpf1	A	G	3: 146,506,538	L349S	probably damaging	Het
Rprd2	G	C	3: 95,765,320	R924G	probably benign	Het
Rps6kc1	T	A	1: 190,773,648	D1039V	probably damaging	Het
Rufy3	G	A	5: 88,645,567	V579I	probably benign	Het
Serpinc1	A	G	1: 160,997,570		probably null	Het
Siae	T	G	9: 37,646,520	I541S	possibly damaging	Het
St14	T	G	9: 31,095,583	D649A	probably benign	Het
Stab2	A	G	10: 86,871,810		probably null	Het
Sun3	T	C	11: 9,038,287	T12A	probably benign	Het
Tdrd6	A	G	17: 43,626,210	Y1316H	probably damaging	Het
Thbs3	CAGAAG	CAG	3: 89,223,102		probably benign	Het
Tmem161b	C	A	13: 84,294,768	T269K	possibly damaging	Het
Trav14-3	T	A	14: 53,763,244	S17T	unknown	Het
Trmu	T	A	15: 85,896,355		probably null	Het
Ttn	T	A	2: 76,707,242	T26454S	possibly damaging	Het
Ubr3	T	C	2: 70,020,446		probably benign	Het
Unc5b	A	T	10: 60,775,100	V376E	probably benign	Het
Usp3	T	C	9: 66,542,532	S166G	possibly damaging	Het
Vldlr	C	A	19: 27,238,812	C344*	probably null	Het
Vmn1r17	A	G	6: 57,360,843	V130A	probably benign	Het
Wdfy3	A	C	5: 101,944,103	Y457D	probably damaging	Het
Zbtb2	T	C	10: 4,369,267	Y253C	possibly damaging	Het
Zfp687	A	C	3: 95,010,386	F692V	probably damaging	Het
Zfp758	A	G	17: 22,375,405	K291E	probably damaging	Het
Zfp799	A	T	17: 32,820,441	C284S	probably damaging	Het
Zp1	C	A	19: 10,920,562	C5F	probably benign	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
R9673:Lats1	UTSW	10	7712623	missense	probably benign	0.29
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCGACTGAAGATCCCAGG -3'
(R):5'- AGGCTTTGGGGATAGCACAG -3'

Sequencing Primer
(F):5'- TCCCAGGCAGGTGAGAAATCC -3'
(R):5'- AGGCAATAACAATCATTCTGTCATAC -3'

Posted On

2016-06-21