Mutagenetix > Incidental Mutation

Incidental Mutation 'R0450:Cog2'

39608

Institutional Source

Beutler Lab

Gene Symbol

Cog2

Ensembl Gene

ENSMUSG00000031979

Gene Name

component of oligomeric golgi complex 2

Synonyms

2700012E02Rik, 1190002B08Rik, Cog2

MMRRC Submission

038650-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0450 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

124520767-124552008 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 124529058 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000034460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034460] [ENSMUST00000176159] [ENSMUST00000176279]

AlphaFold

Q921L5

Predicted Effect

probably null
Transcript: ENSMUST00000034460

SMART Domains

Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979

Domain	Start	End	E-Value	Type
Pfam:COG2	15	147	1.4e-44	PFAM
low complexity region	207	220	N/A	INTRINSIC
low complexity region	490	502	N/A	INTRINSIC
Pfam:DUF3510	565	692	6.1e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000108803

Predicted Effect

probably benign
Transcript: ENSMUST00000176159

SMART Domains

Protein: ENSMUSP00000135600
Gene: ENSMUSG00000031979

Domain	Start	End	E-Value	Type
low complexity region	25	38	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176279

SMART Domains

Protein: ENSMUSP00000135022
Gene: ENSMUSG00000031979

Domain	Start	End	E-Value	Type
Pfam:COG2	15	101	1.5e-37	PFAM

Meta Mutation Damage Score

0.9496

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acoxl	G	A	2: 127,880,503		probably null	Het
AI606181	A	C	19: 41,593,731	K113N	unknown	Het
Ankrd11	T	C	8: 122,892,175	D1646G	possibly damaging	Het
Ap2m1	T	A	16: 20,542,240	I334N	possibly damaging	Het
Arih2	T	A	9: 108,605,092	H490L	possibly damaging	Het
Cdhr1	T	C	14: 37,080,676	Y610C	probably damaging	Het
Cdkal1	C	A	13: 29,691,596		probably null	Het
Cep76	A	T	18: 67,634,780	N227K	probably benign	Het
Clca4b	A	T	3: 144,913,351	Y676N	probably damaging	Het
Col6a4	A	T	9: 106,080,547	V26D	probably damaging	Het
Dcaf11	T	C	14: 55,569,080	V446A	probably damaging	Het
Dync1h1	C	A	12: 110,639,944	Q2483K	probably benign	Het
Enpp3	A	T	10: 24,776,781	D759E	probably damaging	Het
Etfbkmt	C	T	6: 149,150,584	R96W	probably benign	Het
Fam83a	C	A	15: 58,009,926	Q384K	probably benign	Het
Glipr1l2	A	G	10: 112,092,572	D124G	probably benign	Het
Gm8251	T	A	1: 44,061,097	K280N	possibly damaging	Het
Gucy2e	T	C	11: 69,235,576	D326G	probably benign	Het
Hnrnph3	T	A	10: 63,018,215	R41S	probably benign	Het
Hnrnph3	T	A	10: 63,019,500	D2V	probably damaging	Het
Hsh2d	G	A	8: 72,200,460	D229N	probably benign	Het
Itpr2	T	C	6: 146,417,979	T188A	possibly damaging	Het
Krt23	T	A	11: 99,486,782	I133L	probably damaging	Het
Krt74	T	C	15: 101,763,316		noncoding transcript	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Map1a	A	T	2: 121,305,774	H2357L	probably benign	Het
Mbl1	A	G	14: 41,158,749	N198S	probably damaging	Het
Mcf2l	A	G	8: 12,997,337	D233G	probably damaging	Het
Mdga2	T	C	12: 66,470,926	K45E	possibly damaging	Het
Mdn1	A	G	4: 32,738,619	N3524S	probably benign	Het
Mospd3	A	G	5: 137,597,032	L233P	probably damaging	Het
Msto1	A	G	3: 88,911,541	L269P	probably benign	Het
Olfr1138	A	G	2: 87,737,481	V281A	probably damaging	Het
Olfr1238	A	T	2: 89,406,791	M96K	probably damaging	Het
Olfr467	T	C	7: 107,814,688	Y35H	probably damaging	Het
Olfr870	T	C	9: 20,171,265	Y102C	probably benign	Het
Olfr944	G	A	9: 39,217,728	V124I	possibly damaging	Het
Parp2	T	A	14: 50,819,673	Y361N	probably damaging	Het
Pcf11	G	A	7: 92,657,831	P1043L	probably damaging	Het
Phf24	G	T	4: 42,933,761	V48L	possibly damaging	Het
Pkn1	C	A	8: 83,672,324	C678F	probably damaging	Het
Plcl2	T	C	17: 50,607,982	L673P	probably damaging	Het
Ppp1r3c	A	T	19: 36,734,217	F51Y	possibly damaging	Het
Rem2	T	C	14: 54,476,297		probably benign	Het
Smpdl3b	A	G	4: 132,745,138	V108A	probably damaging	Het
Sncaip	A	G	18: 52,868,709	T101A	probably benign	Het
Stk11	T	C	10: 80,126,086	V47A	probably damaging	Het
Tmpo	A	C	10: 91,163,096	I276M	probably benign	Het
Trim55	G	T	3: 19,671,092	V258L	possibly damaging	Het
Ttn	A	G	2: 76,730,412	V29215A	probably damaging	Het
Ubr4	T	G	4: 139,430,223	S2364A	probably benign	Het
Unc79	T	A	12: 103,079,070		probably null	Het
Upb1	T	C	10: 75,415,083		probably null	Het
Usp47	T	C	7: 112,056,580	S155P	possibly damaging	Het
Zfp628	A	T	7: 4,919,733	Q318L	probably benign	Het
Zfp729b	A	T	13: 67,591,134	V1004E	probably benign	Het

Other mutations in Cog2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Cog2	APN	8	124545243	missense	probably benign	0.00
IGL01092:Cog2	APN	8	124545280	missense	probably damaging	1.00
IGL01150:Cog2	APN	8	124542891	missense	possibly damaging	0.62
IGL02052:Cog2	APN	8	124542888	critical splice acceptor site	probably null
IGL02308:Cog2	APN	8	124533212	critical splice acceptor site	probably null
IGL02543:Cog2	APN	8	124529959	missense	probably benign	0.09
IGL02978:Cog2	APN	8	124550336	missense	probably benign
IGL03008:Cog2	APN	8	124535392	splice site	probably benign
IGL03144:Cog2	APN	8	124541024	missense	probably damaging	0.98
kugge	UTSW	8	124550232	missense	probably damaging	1.00
Pelota	UTSW	8	124550306	missense	probably damaging	1.00
PIT4677001:Cog2	UTSW	8	124545271	missense	probably benign	0.22
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0110:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R0436:Cog2	UTSW	8	124548514	splice site	probably benign
R1365:Cog2	UTSW	8	124540974	missense	probably damaging	0.97
R1661:Cog2	UTSW	8	124542890	missense	probably benign	0.20
R1698:Cog2	UTSW	8	124525683	missense	probably damaging	1.00
R1856:Cog2	UTSW	8	124551403	missense	possibly damaging	0.93
R2122:Cog2	UTSW	8	124528985	missense	possibly damaging	0.91
R2398:Cog2	UTSW	8	124529926	missense	probably benign	0.07
R3855:Cog2	UTSW	8	124530003	critical splice donor site	probably null
R4580:Cog2	UTSW	8	124545136	missense	probably benign	0.01
R4803:Cog2	UTSW	8	124535451	missense	probably damaging	0.96
R5316:Cog2	UTSW	8	124529040	missense	probably benign	0.14
R5346:Cog2	UTSW	8	124546631	missense	possibly damaging	0.94
R5394:Cog2	UTSW	8	124532529	missense	probably benign	0.00
R5395:Cog2	UTSW	8	124545221	missense	probably benign	0.00
R5738:Cog2	UTSW	8	124546038	missense	probably benign	0.03
R5861:Cog2	UTSW	8	124537878	missense	probably damaging	1.00
R5894:Cog2	UTSW	8	124545267	missense	probably benign	0.00
R5941:Cog2	UTSW	8	124546086	missense	probably benign
R6186:Cog2	UTSW	8	124546686	missense	probably damaging	1.00
R6400:Cog2	UTSW	8	124550306	missense	probably damaging	1.00
R6518:Cog2	UTSW	8	124527103	nonsense	probably null
R6558:Cog2	UTSW	8	124550232	missense	probably damaging	1.00
R6717:Cog2	UTSW	8	124525749	missense	probably damaging	1.00
R6902:Cog2	UTSW	8	124546691	missense	probably damaging	1.00
R6914:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R6942:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R7103:Cog2	UTSW	8	124541114	critical splice donor site	probably null
R7274:Cog2	UTSW	8	124535519	missense	possibly damaging	0.71
R7641:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R7674:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R8559:Cog2	UTSW	8	124542908	missense	probably benign	0.25
R9190:Cog2	UTSW	8	124533319	missense	probably damaging	1.00
R9307:Cog2	UTSW	8	124527098	critical splice acceptor site	probably null
R9629:Cog2	UTSW	8	124533386	missense	possibly damaging	0.67
X0026:Cog2	UTSW	8	124546020	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- GCACTTAGTCTGCTGTGACCTTGG -3'
(R):5'- CGAATGATGAGCATGAACCGCCTG -3'

Sequencing Primer
(F):5'- ACAGGGATTCATTCATCTCATGC -3'
(R):5'- GTTTGTAGCACGTAACAGACTG -3'

Posted On

2013-05-23