Incidental Mutation 'R5134:Gsk3b'
ID396081
Institutional Source Beutler Lab
Gene Symbol Gsk3b
Ensembl Gene ENSMUSG00000022812
Gene Nameglycogen synthase kinase 3 beta
SynonymsGSK-3beta, 7330414F15Rik, GSK3, GSK-3, 8430431H08Rik
MMRRC Submission 042722-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R5134 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location38089001-38246084 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38240520 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 418 (R418H)
Ref Sequence ENSEMBL: ENSMUSP00000110398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023507] [ENSMUST00000114750]
Predicted Effect probably damaging
Transcript: ENSMUST00000023507
AA Change: R405H

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023507
Gene: ENSMUSG00000022812
AA Change: R405H

DomainStartEndE-ValueType
S_TKc 56 340 1.72e-86 SMART
low complexity region 386 402 N/A INTRINSIC
low complexity region 409 419 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114750
AA Change: R418H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110398
Gene: ENSMUSG00000022812
AA Change: R418H

DomainStartEndE-ValueType
S_TKc 56 353 1.13e-86 SMART
low complexity region 399 415 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000231437
AA Change: V24M
Meta Mutation Damage Score 0.1325 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene may die embryonically around mid-gestation or neonatally. When mice die neonatally, cleft palate and sternum are present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
7420426K07Rik T C 9: 98,903,740 S153P probably benign Het
Adarb1 T A 10: 77,325,845 probably benign Het
Adrb3 A C 8: 27,227,770 M217R probably damaging Het
Ank2 A T 3: 126,963,445 N1054K possibly damaging Het
Aox4 A T 1: 58,236,676 D389V probably benign Het
Aph1a G T 3: 95,895,531 G148W probably damaging Het
Arsj A G 3: 126,438,154 D183G probably benign Het
Atg2b A G 12: 105,674,950 S76P probably damaging Het
Atxn7l1 C A 12: 33,372,876 N815K probably damaging Het
Cd3d A T 9: 44,984,998 E28D probably damaging Het
Cir1 G A 2: 73,284,503 R404* probably null Het
Cops8 A G 1: 90,611,002 D51G probably damaging Het
Csgalnact1 T C 8: 68,460,971 E194G probably benign Het
Cstf2t T A 19: 31,084,094 D343E probably damaging Het
Ddx23 A T 15: 98,650,770 D352E possibly damaging Het
Dhx34 G T 7: 16,218,250 A150D possibly damaging Het
Dnal4 A T 15: 79,763,565 V32E possibly damaging Het
Dvl3 G T 16: 20,524,607 probably benign Het
Ehmt1 G T 2: 24,877,497 P135T probably damaging Het
Enpp2 C T 15: 54,899,330 R174H probably damaging Het
Eps15 G A 4: 109,366,530 probably benign Het
F10 T C 8: 13,055,698 V421A probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fer1l6 A T 15: 58,640,154 D1490V probably damaging Het
Fsd1l A G 4: 53,647,766 K70E probably benign Het
Galnt12 G A 4: 47,113,818 A79T probably damaging Het
Galnt17 A T 5: 130,964,035 M347K probably damaging Het
Glyatl3 A G 17: 40,905,030 V195A probably benign Het
Gm10770 A T 2: 150,179,560 probably null Het
Gm5578 A T 6: 112,606,085 noncoding transcript Het
Grn C A 11: 102,430,554 probably benign Het
Hspa12b A G 2: 131,139,508 E221G possibly damaging Het
Ighv1-50 T G 12: 115,120,033 Q22H probably benign Het
Ipcef1 A G 10: 6,919,950 I150T probably benign Het
Ipp T A 4: 116,515,457 F228I possibly damaging Het
Itgb7 A G 15: 102,217,407 C596R probably damaging Het
Kif27 T C 13: 58,291,090 D1219G possibly damaging Het
Lats1 T A 10: 7,691,811 D115E probably benign Het
Lpcat3 A G 6: 124,702,530 N331S probably benign Het
Lrpprc A T 17: 84,751,256 N725K probably benign Het
Lss T G 10: 76,546,236 probably benign Het
Mfsd6 T C 1: 52,708,356 Y450C possibly damaging Het
Mmp21 A T 7: 133,679,013 V76E probably benign Het
Mtmr11 A T 3: 96,169,907 Y527F probably damaging Het
Mum1 T C 10: 80,232,868 L282P probably benign Het
Nat10 A T 2: 103,743,293 F327I probably benign Het
Nfkbiz A T 16: 55,818,500 M199K probably damaging Het
Nuak1 A G 10: 84,374,350 Y625H probably benign Het
Odf1 A G 15: 38,226,149 T98A possibly damaging Het
Olfr1274-ps T A 2: 90,400,763 M34K probably benign Het
Olfr1513 T C 14: 52,349,791 N85S probably benign Het
Olfr350 A T 2: 36,850,476 L143F probably benign Het
Oprl1 T A 2: 181,718,610 I153N probably damaging Het
Osbpl8 T A 10: 111,288,693 D705E probably benign Het
Otud4 G A 8: 79,655,689 V176I probably damaging Het
Paics T C 5: 76,956,822 probably benign Het
Pax5 A G 4: 44,710,407 M1T probably null Het
Pck1 A T 2: 173,153,489 N34I probably benign Het
Pde8b T C 13: 95,086,742 I335V probably benign Het
Piezo2 A G 18: 63,074,620 V1440A probably damaging Het
Ptpre T A 7: 135,652,092 F83Y probably damaging Het
Rassf6 T A 5: 90,604,366 probably null Het
Rilp A T 11: 75,512,708 L325F probably damaging Het
Rpf1 A G 3: 146,506,538 L349S probably damaging Het
Rprd2 G C 3: 95,765,320 R924G probably benign Het
Rps6kc1 T A 1: 190,773,648 D1039V probably damaging Het
Rufy3 G A 5: 88,645,567 V579I probably benign Het
Serpinc1 A G 1: 160,997,570 probably null Het
Siae T G 9: 37,646,520 I541S possibly damaging Het
St14 T G 9: 31,095,583 D649A probably benign Het
Stab2 A G 10: 86,871,810 probably null Het
Sun3 T C 11: 9,038,287 T12A probably benign Het
Tdrd6 A G 17: 43,626,210 Y1316H probably damaging Het
Thbs3 CAGAAG CAG 3: 89,223,102 probably benign Het
Tmem161b C A 13: 84,294,768 T269K possibly damaging Het
Trav14-3 T A 14: 53,763,244 S17T unknown Het
Trmu T A 15: 85,896,355 probably null Het
Ttn T A 2: 76,707,242 T26454S possibly damaging Het
Ubr3 T C 2: 70,020,446 probably benign Het
Unc5b A T 10: 60,775,100 V376E probably benign Het
Usp3 T C 9: 66,542,532 S166G possibly damaging Het
Vldlr C A 19: 27,238,812 C344* probably null Het
Vmn1r17 A G 6: 57,360,843 V130A probably benign Het
Wdfy3 A C 5: 101,944,103 Y457D probably damaging Het
Zbtb2 T C 10: 4,369,267 Y253C possibly damaging Het
Zfp687 A C 3: 95,010,386 F692V probably damaging Het
Zfp758 A G 17: 22,375,405 K291E probably damaging Het
Zfp799 A T 17: 32,820,441 C284S probably damaging Het
Zp1 C A 19: 10,920,562 C5F probably benign Het
Other mutations in Gsk3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gsk3b APN 16 38228707 missense probably benign
IGL01302:Gsk3b APN 16 38220018 missense probably benign 0.01
blue_bunny UTSW 16 38208136 intron probably benign
PIT4402001:Gsk3b UTSW 16 38089401 unclassified probably benign
PIT4585001:Gsk3b UTSW 16 38184454 missense probably damaging 1.00
R0670:Gsk3b UTSW 16 38144316 missense probably damaging 1.00
R1118:Gsk3b UTSW 16 38207984 unclassified probably benign
R1119:Gsk3b UTSW 16 38207984 unclassified probably benign
R1428:Gsk3b UTSW 16 38090575 missense probably benign 0.01
R1897:Gsk3b UTSW 16 38217084 splice site probably null
R2056:Gsk3b UTSW 16 38187909 missense probably benign
R2058:Gsk3b UTSW 16 38187909 missense probably benign
R2059:Gsk3b UTSW 16 38187909 missense probably benign
R4428:Gsk3b UTSW 16 38193936 missense probably damaging 1.00
R4594:Gsk3b UTSW 16 38170701 missense possibly damaging 0.92
R5133:Gsk3b UTSW 16 38240520 missense probably damaging 0.99
R5726:Gsk3b UTSW 16 38208136 intron probably benign
R5957:Gsk3b UTSW 16 38193953 missense probably damaging 1.00
R6273:Gsk3b UTSW 16 38208046 missense probably benign 0.00
R6431:Gsk3b UTSW 16 38193949 missense probably damaging 0.99
R8344:Gsk3b UTSW 16 38191625 missense probably benign 0.07
Z1176:Gsk3b UTSW 16 38208070 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCCTAGCAGAAAGGAAGTCC -3'
(R):5'- TCTTGGATCTCCTGAAAAGTGAG -3'

Sequencing Primer
(F):5'- CTGGTGCTGTGTGTTTGAACCC -3'
(R):5'- TGGATCTCCTGAAAAGTGAGAATAC -3'
Posted On2016-06-21