Incidental Mutation 'R5135:Olfr1253'
ID396098
Institutional Source Beutler Lab
Gene Symbol Olfr1253
Ensembl Gene ENSMUSG00000075075
Gene Nameolfactory receptor 1253
SynonymsMOR231-19P, MOR231-18, MOR231-19P, GA_x6K02T2Q125-51193814-51192857, Olfr1253-ps1, Olfr1559-ps1
MMRRC Submission 043261-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5135 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89749467-89757090 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89751895 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 311 (L311H)
Ref Sequence ENSEMBL: ENSMUSP00000151024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099765] [ENSMUST00000213484] [ENSMUST00000215185] [ENSMUST00000215988]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099765
AA Change: L311H

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097353
Gene: ENSMUSG00000075075
AA Change: L311H

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 9.2e-46 PFAM
Pfam:7tm_1 39 285 1.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213484
AA Change: L311H

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215185
AA Change: L311H

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215988
AA Change: L311H

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T C 1: 184,033,506 S119G probably benign Het
4930553M12Rik G T 4: 88,868,271 H37N unknown Het
Adam10 T A 9: 70,766,074 C496S probably damaging Het
Akap2 G T 4: 57,855,912 A414S probably benign Het
Aldh18a1 A C 19: 40,554,817 probably benign Het
Alox5 A G 6: 116,413,786 F468S probably benign Het
Ankrd50 T C 3: 38,455,803 H805R probably damaging Het
Ap2s1 T A 7: 16,747,323 D72E probably damaging Het
Apaf1 T C 10: 91,060,094 Y372C probably damaging Het
Apob C T 12: 8,010,086 T2823I probably damaging Het
Bhmt A G 13: 93,627,323 V70A probably damaging Het
Cdc42bpg T A 19: 6,320,618 L1247H probably damaging Het
Cel A G 2: 28,559,423 V264A probably benign Het
Celsr2 T C 3: 108,398,659 N2043S probably damaging Het
Clca4a A T 3: 144,954,946 W706R probably damaging Het
Col22a1 G T 15: 71,799,337 P1058Q unknown Het
Cyp4a14 A G 4: 115,489,960 probably null Het
Dhx30 T G 9: 110,098,795 R55S probably damaging Het
Dlgap5 C T 14: 47,399,665 R452H probably damaging Het
Dnah12 T A 14: 26,770,477 D1191E probably damaging Het
Dock3 A T 9: 106,932,997 I164N probably damaging Het
Edrf1 T A 7: 133,651,044 M436K probably benign Het
Eif2ak2 T A 17: 78,866,345 Y268F probably damaging Het
Evi2a G A 11: 79,527,451 T111M possibly damaging Het
Fzd4 A G 7: 89,407,501 E252G probably damaging Het
Gcm2 A G 13: 41,102,959 V438A probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gm21994 A T 2: 150,255,490 Y34* probably null Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm4846 T C 1: 166,483,982 D436G probably damaging Het
Gm5414 T A 15: 101,627,768 I141F probably damaging Het
Gm6185 T A 1: 161,198,231 noncoding transcript Het
Grip2 T C 6: 91,773,916 E776G possibly damaging Het
H2-Ob T A 17: 34,243,516 V160E probably benign Het
Hormad1 T C 3: 95,585,220 probably benign Het
Ighv2-1 A T 12: 113,574,462 probably benign Het
Igkv4-92 A T 6: 68,755,554 C14S probably benign Het
Iqsec3 T C 6: 121,383,919 I993M probably damaging Het
Kdm5b T A 1: 134,588,746 probably benign Het
Kitl T C 10: 100,088,222 probably null Het
Klhl26 G T 8: 70,452,718 R100S probably benign Het
Kpna4 C T 3: 69,092,809 probably null Het
Lama5 T A 2: 180,202,220 N383Y possibly damaging Het
Large1 T G 8: 72,818,096 I685L probably benign Het
Larp4b A G 13: 9,170,737 E590G probably damaging Het
Liph A T 16: 21,956,165 C425* probably null Het
Lrrc31 A T 3: 30,684,890 C327* probably null Het
Lrrc36 T C 8: 105,463,898 V733A probably benign Het
Mmel1 T A 4: 154,882,324 I83K probably benign Het
Myo16 G T 8: 10,476,114 V885L probably benign Het
Naip2 A T 13: 100,179,440 N277K probably damaging Het
Ncapg2 T A 12: 116,427,786 I485N possibly damaging Het
Npc1l1 A T 11: 6,224,245 Y687N possibly damaging Het
Obscn A T 11: 59,129,653 V922E probably damaging Het
Oc90 A G 15: 65,883,830 S223P probably benign Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1508 T C 14: 52,463,854 I52V probably benign Het
Pdlim5 C T 3: 142,304,365 R174H probably benign Het
Pex5l G T 3: 32,955,831 A386E probably damaging Het
Plcxd1 T A 5: 110,101,363 probably benign Het
Pramef8 T G 4: 143,419,009 S349R probably benign Het
Prl8a1 A T 13: 27,579,819 probably null Het
Ryr2 G T 13: 11,662,130 N3278K probably benign Het
Sacm1l A G 9: 123,577,025 M324V probably benign Het
Sdad1 T C 5: 92,303,934 T143A probably benign Het
Sec11a A T 7: 80,923,064 probably benign Het
Sema6a A G 18: 47,291,172 V223A probably damaging Het
Serpinb6c A G 13: 33,880,097 V325A probably damaging Het
Slc4a2 G A 5: 24,430,127 A177T possibly damaging Het
Slc5a4a A G 10: 76,147,594 N22D unknown Het
Stard13 C T 5: 151,062,767 W308* probably null Het
Tanc2 C T 11: 105,857,553 L504F possibly damaging Het
Tfap2e G T 4: 126,720,544 N282K probably damaging Het
Uhrf1bp1l T C 10: 89,789,355 I48T probably damaging Het
Usp36 G T 11: 118,264,905 T682K possibly damaging Het
Zc3h11a T C 1: 133,633,789 T315A probably benign Het
Zfa-ps T A 10: 52,543,022 noncoding transcript Het
Zfp663 A T 2: 165,353,670 C210S possibly damaging Het
Zfp747 T C 7: 127,374,394 I201M probably damaging Het
Zic4 C T 9: 91,384,152 T276M probably damaging Het
Other mutations in Olfr1253
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01938:Olfr1253 APN 2 89752348 missense probably benign 0.12
IGL02287:Olfr1253 APN 2 89752614 nonsense probably null
IGL03149:Olfr1253 APN 2 89752828 splice site probably null
R0017:Olfr1253 UTSW 2 89752021 missense possibly damaging 0.67
R1466:Olfr1253 UTSW 2 89752267 missense probably damaging 1.00
R1466:Olfr1253 UTSW 2 89752267 missense probably damaging 1.00
R1584:Olfr1253 UTSW 2 89752267 missense probably damaging 1.00
R2008:Olfr1253 UTSW 2 89752073 missense possibly damaging 0.57
R2484:Olfr1253 UTSW 2 89752234 missense probably benign 0.00
R5648:Olfr1253 UTSW 2 89752073 missense probably damaging 0.99
R6021:Olfr1253 UTSW 2 89752121 missense probably benign 0.13
R6952:Olfr1253 UTSW 2 89752627 missense possibly damaging 0.64
R7039:Olfr1253 UTSW 2 89752751 missense probably benign 0.01
R7088:Olfr1253 UTSW 2 89752099 missense probably benign 0.01
R7443:Olfr1253 UTSW 2 89751941 missense probably benign 0.01
R7444:Olfr1253 UTSW 2 89752759 missense probably benign 0.01
R7538:Olfr1253 UTSW 2 89752321 missense probably damaging 1.00
R7594:Olfr1253 UTSW 2 89752562 missense probably benign 0.32
R7818:Olfr1253 UTSW 2 89751944 missense possibly damaging 0.90
R7964:Olfr1253 UTSW 2 89752814 missense possibly damaging 0.63
R8358:Olfr1253 UTSW 2 89752079 missense probably benign 0.24
R8438:Olfr1253 UTSW 2 89752717 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATAGCTTGAAGGATATAGTAGACCAG -3'
(R):5'- TGCATTTCCCATATCACTGTGG -3'

Sequencing Primer
(F):5'- GAGATATTATATGCAGGCAGCTATAC -3'
(R):5'- CCCTGTATTTTCATGTATGTTAGACC -3'
Posted On2016-06-21