Incidental Mutation 'R0450:Olfr944'
ID39610
Institutional Source Beutler Lab
Gene Symbol Olfr944
Ensembl Gene ENSMUSG00000096555
Gene Nameolfactory receptor 944
SynonymsGA_x6K02T2PVTD-32914568-32915503, MOR171-19
MMRRC Submission 038650-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R0450 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39201920-39218421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 39217728 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 124 (V124I)
Ref Sequence ENSEMBL: ENSMUSP00000150471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079650] [ENSMUST00000213908] [ENSMUST00000215306]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079650
AA Change: V124I

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078595
Gene: ENSMUSG00000096555
AA Change: V124I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.5e-47 PFAM
Pfam:7tm_1 41 290 2.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213908
AA Change: V124I

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215306
AA Change: V124I

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl G A 2: 127,880,503 probably null Het
AI606181 A C 19: 41,593,731 K113N unknown Het
Ankrd11 T C 8: 122,892,175 D1646G possibly damaging Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Arih2 T A 9: 108,605,092 H490L possibly damaging Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Cdkal1 C A 13: 29,691,596 probably null Het
Cep76 A T 18: 67,634,780 N227K probably benign Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Cog2 T C 8: 124,529,058 probably null Het
Col6a4 A T 9: 106,080,547 V26D probably damaging Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Dync1h1 C A 12: 110,639,944 Q2483K probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Etfbkmt C T 6: 149,150,584 R96W probably benign Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Glipr1l2 A G 10: 112,092,572 D124G probably benign Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
Hnrnph3 T A 10: 63,018,215 R41S probably benign Het
Hnrnph3 T A 10: 63,019,500 D2V probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Itpr2 T C 6: 146,417,979 T188A possibly damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdga2 T C 12: 66,470,926 K45E possibly damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Mospd3 A G 5: 137,597,032 L233P probably damaging Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr467 T C 7: 107,814,688 Y35H probably damaging Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Pcf11 G A 7: 92,657,831 P1043L probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pkn1 C A 8: 83,672,324 C678F probably damaging Het
Plcl2 T C 17: 50,607,982 L673P probably damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Rem2 T C 14: 54,476,297 probably benign Het
Smpdl3b A G 4: 132,745,138 V108A probably damaging Het
Sncaip A G 18: 52,868,709 T101A probably benign Het
Stk11 T C 10: 80,126,086 V47A probably damaging Het
Tmpo A C 10: 91,163,096 I276M probably benign Het
Trim55 G T 3: 19,671,092 V258L possibly damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ubr4 T G 4: 139,430,223 S2364A probably benign Het
Unc79 T A 12: 103,079,070 probably null Het
Upb1 T C 10: 75,415,083 probably null Het
Usp47 T C 7: 112,056,580 S155P possibly damaging Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Zfp729b A T 13: 67,591,134 V1004E probably benign Het
Other mutations in Olfr944
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Olfr944 APN 9 39218116 missense probably damaging 1.00
IGL01529:Olfr944 APN 9 39218131 missense probably benign 0.30
IGL03307:Olfr944 APN 9 39218013 missense probably benign 0.03
R0110:Olfr944 UTSW 9 39217728 missense possibly damaging 0.50
R0413:Olfr944 UTSW 9 39218270 missense probably benign 0.25
R2108:Olfr944 UTSW 9 39218022 missense probably damaging 0.99
R2112:Olfr944 UTSW 9 39217779 missense probably benign 0.01
R4666:Olfr944 UTSW 9 39217846 missense probably damaging 0.97
R5039:Olfr944 UTSW 9 39218114 nonsense probably null
R6384:Olfr944 UTSW 9 39217978 missense probably benign 0.06
R8124:Olfr944 UTSW 9 39217671 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGCATGATCACACTGATTGGG -3'
(R):5'- ACACAGAGGACACTTTTGCTTGGC -3'

Sequencing Primer
(F):5'- CAGGAGTCTGTCCTTCATTGAC -3'
(R):5'- CCCTCACTGGAGTGAATGTAG -3'
Posted On2013-05-23